Cart 11 Product Products 1 298,70 € (empty)
-
1 x CHMP6-chro...113,40 € -
-
1 x KRR1-KRR1,...121,50 € -
1 x PVRL3-poli...121,50 € -
1 x SLC22A24-s...121,50 € -
1 x CTSE-cathe...121,50 € -
-
-
1 x CD34-CD34...121,50 € -
1 x NINJ2-ninj...113,40 € -
1 x MFSD5-majo...121,50 €
No products
To be determined Shipping
1 298,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 298,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 298,70 €
View larger 
KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
PTXBC109203
New product
Data sheet of KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC109203 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNG4 |
| Origin species: | Human |
| Product name: | KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC109203 |
| Gene id: | 93107 |
| Gene description: | potassium voltage-gated channel, subfamily G, member 4 |
| Synonyms: | KV6.3; KV6.4; potassium voltage-gated channel subfamily G member 4; potassium channel, voltage gated modifier subfamily G, member 4; potassium voltage-gated channel, subfamily G, member 4; voltage-gated potassium channel Kv6.3; voltage-gated potassium channel subunit Kv6.4; potassium voltage-gated channel modifier subfamily G member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccatgccttccagagacgggggcctgcatcccagacaccaccactatggttcccacagcccttggagtcagctcctgtccagccccatggagacgccgtccatcaagggcctttactaccggagggtgcggaaggtgggtgccctggacgcctccccagtggacctgaagaaggagatcctgatcaacgtggggggcaggaggtatctcctcccctggagcacactggaccggttcccgctgagccgcctgagcaaactcaggctctgtcggagctacgaggagatcgtgcagctctgcgatgattacgacgaggacagccaggagttcttcttcgacaggagccccagcgccttcggggtgatcgtgagcttcctggcggccgggaagctggtgcttctgcaggagatgtgcgcgctgtccttccaggaggagctggcctactggggcatcgaggaggcccacctggagaggtgctgcctgcggaagctgctgaggaagctggaggagctggaggagctggccaagctgcacagggaggacgtactgaggcagcagagggagacccgccgccccgcctcgcactcctcgcgctggggcctgtgcatgaaccggctgcgcgagatggtggaaaacccgcagtccgggctgcccgggaaggtcttcgcttgcctctccatcctcttcgtggccaccacagccgtcagcctgtgtgtcagcaccatgcccgacctcagggcagaggaggaccagggcgaatgctctcggaagtgctactatattttcatcgtggagaccatctgcgtggcctggttctccctggagttctgcctgcggtttgtccaggcccaagacaagtgtcagttcttccaggggcccctgaacatcatcgacatcctggccatctccccatactacgtgtcgctggcggtgtctgaggagcccccggaggacggcaagaggccgagcgggagctcctacctggagaaggtggggctggtcctgcgtgtgctgcgagcgctgcgcatcctctacgtgatgcgcctggctcgccactcgctggggctgcagacgctggggctcaccgtgcgccgttgcacacgtgagttcggcctgctccttctcttcctggccgtggccatcaccctcttctcccctttggtctacgtggccgagaaggagtccgggcgggtgctggagttcaccagcatccccgcctcctattggtgggccatcatctccatgacaacggtgggctacggggacatggtgccccacagtgtgccaggccagatggtggccctcagcagcatcctgagcgggatcctcatcatggccttcccggccacgtctatcttccacaccttctcccactcctacctggagctcaagaaggagcaggagcagcttcaggcccgcctccgccacctccaaaacaccggtccagccagtgaatgtgaactcctggacccccatgtggccagtgaacatgagctcatgaacgatgtcaatgacctaatcctggagggcccagccttgcctatcatgcacatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-bound transcription factor peptidase, site 1 - ATP-binding cassette, sub-family B (MDR/TAP), member 8 - ATP-binding cassette, sub-family B (MDR/TAP), member 8 - vacuolar protein sorting 37 homolog C (S. cerevisiae) |