Cart 52 Product Products 10 284,79 € (empty)
-
1 x Goat...219,00 € -
1 x NARFL-nucl...121,50 € -
1 x ZNF774-zin...121,50 € -
1 x KLK4-kalli...113,40 € -
1 x DYNC2LI1-d...121,50 € -
-
-
1 x MARCKS-myr...121,50 € -
-
-
-
1 x CCDC97-coi...121,50 € -
-
1 x PSTK-phosp...121,50 € -
1 x IL1RL1-int...121,50 € -
1 x MGC26718-s...113,40 € -
-
-
-
-
1 x MOSC2-MOCO...121,50 € -
1 x DDX19A-DEA...121,50 € -
1 x LOC222699-...113,40 € -
1 x TRIM55-tri...121,50 € -
-
-
-
1 x GNB2L1-gua...121,50 € -
-
1 x ST3GAL2-ST...121,50 € -
1 x IHH-Indian...121,50 € -
1 x ZCCHC7-zin...121,50 € -
1 x MT1DP-meta...113,40 € -
1 x TAAR5...259,07 € -
1 x TGF-beta1469,00 € -
1 x PCID2-PCI...121,50 € -
1 x CAPG-cappi...121,50 € -
1 x BUB3-buddi...121,50 € -
-
1 x ACTR1A-ARP...121,50 € -
1 x WNT3A-wing...121,50 € -
-
-
-
-
-
-
1 x S100PBP-S1...121,50 € -
-
-
1 x Corticoste...544,00 € -
No products
To be determined Shipping
10 284,79 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 52 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 10 284,79 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 10 284,79 €
View larger 
CYP26B1-cytochrome P450, family 26, subfamily B, polypeptide 1 Gene
PTXBC109205
New product
Data sheet of CYP26B1-cytochrome P450, family 26, subfamily B, polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP26B1-cytochrome P450, family 26, subfamily B, polypeptide 1 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC109205 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP26B1 |
| Origin species: | Human |
| Product name: | CYP26B1-cytochrome P450, family 26, subfamily B, polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC109205 |
| Gene id: | 56603 |
| Gene description: | cytochrome P450, family 26, subfamily B, polypeptide 1 |
| Synonyms: | CYP26A2; P450RAI-2; P450RAI2; RHFCA; cytochrome P450 26B1; cytochrome P450 family 26 subfamily A member 1; cytochrome P450 retinoic acid-inactivating 2; cytochrome P450 retinoid metabolizing protein; cytochrome P450, family 26, subfamily B, polypeptide 1; cytochrome P450, subfamily XXVIB, polypeptide 1; retinoic acid-metabolizing cytochrome; cytochrome P450 family 26 subfamily B member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctctttgagggcttggatctggtgtcggcgctggccaccctcgccgcgtgcctggtgtccgtgacgctgctgctggccgtgtcgcagcagctgtggcagctgcgctgggccgccactcgcgacaagagctgcaagctgcccatccccaagggatccatgggcttcccgctcatcggagagaccggccactggctgctgcagggttctggcttccagtcgtcgcggagggagaagtatggcaacgtgttcaagacgcatttgttggggcggccgctgatacgcgtgaccggcgcggagaacgtgcgcaagatcctcatgggcgagcaccacctcgtgagcaccgagtggcctcgcagcacccgcatgttgctgggccccaacacggtgtccaattccattggcgacatccaccgcaacaagcgcaaggtcttctccaagatcttcagccacgaggccctggagagttacctgcccaagatccagctggtgatccaggacacactgcgcgcctggagcagccaccccgaggccatcaacgtgtaccaggaggcgcagaagctgaccttccgcatggccatccgggtgctgctgggcttcagcatccctgaggaggaccttgggcacctctttgaggtctaccagcagtttgtggacaatgtcttctccctgcctgtcgacctgcccttcagtggctaccggcggggcattcaggctcggcagatcctgcagaaggggctggagaaggccatccgggagaagctgcagtgcacacagggcaaggactacttggacgccctggacctcctcattgagagcagcaaggagcacgggaaggagatgaccatgcaggagctgaaggacgggaccctggagctgatctttgcggcctatgccaccacggccagcgccagcacctcactcatcatgcagctgctgaagcaccccactgtgctggagaagctgcgggatgagctgcgggctcatggcatcctgcacagtggcggctgcccctgcgagggcacactgcgcctggacacgctcagtgggctgcgctacctggactgcgtcatcaaggaggtcatgcgcctgttcacgcccatttccggcggctaccgcactgtgctgcagaccttcgagcttgatggtttccagatccccaaaggctggagtgtcatgtatagcatccgggacacccatgacacagcgcccgtgttcaaagacgtgaacgtgttcgaccccgatcgcttcagccaggcgcggagcgaggacaaggatggccgcttccattacctcccgttcggtggcggtgtccggacctgcctgggcaagcacctggccaagctgttcctgaaggtgctggcggtggagctggctagcaccagccgctttgagctggccacacggaccttcccccgcatcaccttggtccccgtcctgcaccccgtggatggcctcagcgtcaagttctttggcctggactccaaccagaacgagatcctgccggagacggaggccatgctgagcgccacagtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 11, subfamily B, polypeptide 1 - suppressor of variegation 4-20 homolog 1 (Drosophila) - Rho guanine nucleotide exchange factor (GEF) 10-like - glutamate receptor, ionotropic, N-methyl D-aspartate 2A |