Cart 23 Product Products 2 605,46 € (empty)
-
1 x PSMC2-prot...121,50 € -
1 x NUDT2-nudi...113,40 € -
1 x LMAN2L-lec...121,50 € -
1 x C7orf49-ch...113,40 € -
1 x GLO1-glyox...113,40 € -
1 x DUT-deoxyu...113,40 € -
1 x C1orf123-c...113,40 € -
1 x CD200R1-CD...121,50 € -
1 x IMP3-IMP3,...113,40 € -
1 x COG3-compo...121,50 € -
-
-
1 x LIN28-lin-...113,40 € -
1 x XIRP2-xin...113,40 € -
-
1 x C11orf59-c...113,40 € -
1 x SNRPB-smal...113,40 € -
1 x USP47-ubiq...113,40 € -
1 x IL20RB-int...121,50 € -
1 x SLAMF1-sig...121,50 € -
-
1 x PFDN4-pref...113,40 € -
1 x TM6SF1-tra...113,40 €
No products
To be determined Shipping
2 605,46 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 605,46 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 605,46 €
Data sheet of PNMA5-paraneoplastic antigen like 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PNMA5-paraneoplastic antigen like 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101112 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PNMA5 |
| Origin species: | Human |
| Product name: | PNMA5-paraneoplastic antigen like 5 Gene |
| Size: | 2ug |
| Accessions: | BC101112 |
| Gene id: | 114824 |
| Gene description: | paraneoplastic antigen like 5 |
| Synonyms: | paraneoplastic antigen-like protein 5; tumor antigen BJ-HCC-25; paraneoplastic Ma antigen family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcactgacactgctagaggattggtgcaaggggatggacatggaccccagaaaggccctgctgattgtaggcatccccatggagtgtagtgaggtggaaattcaggacactgtgaaggcaggcttacagcccctgtgcgcatacagggtcctagggagaatgttcaggagggaagacaatgccaaggcagtcttcattgaactggctgacactgtcaattacactactctgcccagtcacataccaggaaagggtggctcctgggaagtggtggtaaaaccccgtaacccagatgatgagtttctcagtagactgaactacttcctgaaagatgagggccgaagtatgacagatgtggccagagccctgggatgttgcagcctccctgccgagagcctggatgcagaggtcatgccccaagttagatccccacctttagagcctccgaaagaaagtatgtggtacaggaaactgaaagtgttttcgggaactgcttcccctagcccaggcgaagagacctttgaagactggctagagcaggtcactgagataatgcccatatggcaagtgtctgaggtggagaagaggcggcgtttgctggagagcttacgtgggcctgctctgtcaatcatgcgggtgctccaggccaacaatgactccataactgtggagcagtgccttgacgccctaaagcagatctttggggataaagaggactttggagcctctcagtttaggtttctgcagacctctccgaagattggagagaaagtctccactttcctgctgcgcttagagcccctgctgcagaaagccgtgcacaagagccccttgtcagtgcgcagcacagacatgattcgtctgaaacatctcttagctcgggtcgccatgacccccgccctcaggggcaagctggagctcttggatcagcgagggtgtcctcccaattttctggagttaatgaagctcattcgagatgaagaagagtgggagaacactgaggcagtgatgaagaataaggagaagccatcagggagaggccggggggcctccggtagacaggcaagagcagaagccagtgtctctgcacctcaggccaccgtgcaggcaaggtcttttagcgacagcagcccccagaccatacagggaggcttacccccattagtgaaacgcaggcggctgttaggcagtgaaagcactaggggagaagaccatggccaggccacgtatcccaaggctgaaaaccagactccaggcagggaggggccacaggctgcaggagaggagttgggaaacgaggcaggggctggggccatgagccatcccaagccctgggaaacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - jumonji domain containing 2D - activin A receptor, type IIB - BTB (POZ) domain containing 9 - Vac14 homolog (S. cerevisiae) |