Cart 2 Product Products 225,44 € (empty)
-
1 x PYCR1-pyrr...113,40 € -
No products
To be determined Shipping
225,44 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 225,44 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 225,44 €
View larger 
CYP2A6-cytochrome P450, family 2, subfamily A, polypeptide 6 Gene
PTXBC096253
New product
Data sheet of CYP2A6-cytochrome P450, family 2, subfamily A, polypeptide 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP2A6-cytochrome P450, family 2, subfamily A, polypeptide 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096253 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP2A6 |
| Origin species: | Human |
| Product name: | CYP2A6-cytochrome P450, family 2, subfamily A, polypeptide 6 Gene |
| Size: | 2ug |
| Accessions: | BC096253 |
| Gene id: | 1548 |
| Gene description: | cytochrome P450, family 2, subfamily A, polypeptide 6 |
| Synonyms: | CPA6; CYP2A; CYP2A3; CYPIIA6; P450C2A; P450PB; cytochrome P450 2A6; 1,4-cineole 2-exo-monooxygenase; coumarin 7-hydroxylase; cytochrome P450 IIA3; cytochrome P450(I); cytochrome P450, family 2, subfamily A, polypeptide 6; cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6; flavoprotein-linked monooxygenase; xenobiotic monooxygenase; cytochrome P450 family 2 subfamily A member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggcctcagggatgcttctggtggccttgctggtctgcctgactgtgatggtcttgatgtctgtttggcagcagaggaagagcaaggggaagctgcctccgggacccaccccattgcccttcattggaaactacctgcaactgaacacagagcagatgtacaactccctcatgaagatcagtgagcgctatggccccgtgttcaccattcacttggggccccggcgggtcgtggtgctgtgtggacatgatgccgtcagggaggctctggtggaccaggctgaggagttcagcgggcgaggcgagcaagccaccttcgactgggtcttcaaaggctatggcgtggtattcagcaacggggagcgcgccaagcagctccggcgcttctccatcgccaccctgcgggacttcggggtgggcaagcgaggcatcgaggagcgcatccaggaggaggcgggcttcctcatcgacgccctccggggcactggcggcgccaatatcgatcccaccttcttcctgagccgcacagtctccaatgtcatcagctccattgtctttggggaccgctttgactataaggacaaagagttcctgtcactgttgcgcatgatgctaggaatcttccagttcacgtcaacctccacggggcagctctatgagatgttctcttcggtgatgaaacacctgccaggaccacagcaacaggcctttcagttgctgcaagggctggaggacttcatagccaagaaggtggagcacaaccagcgtacgctggatcccaattccccacgggacttcattgactcctttctcatccgcatgcaggaggaggagaagaaccccaacacggagttctacttgaaaaacctggtgatgaccacgttgaacctcttcattgggggcaccgagaccgtcagcaccaccctgcgctatggcttcttgctgctcatgaagcacccagaggtggaggccaaggtccatgaggagattgacagagtgatcggcaagaaccggcagcccaagtttgaggaccgggccaagatgccctacatggaggcagtgatccacgagatccaaagatttggagacgtgatccccatgagtttggcccgcagagtcaaaaaggacaccaagtttcgggatttcttcctccctaagggcaccgaagtgtaccctatgctgggctctgtgctgagagaccccagtttcttctccaacccccaggacttcaatccccagcatttcctgaatgagaaggggcagtttaagaagagtgatgcttttgtgcccttttccatcggaaagcggaactgtttcggagaaggcctggccagaatggagctctttctcttcttcaccaccgtcatgcagaacttccgcctcaagtcctcccagtcacctaaggacattgacgtgtcccccaaacacgtgggctttgccacgatcccacgaaactacaccatgagcttcctgccccgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 - aryl hydrocarbon receptor nuclear translocator-like 2 - potassium voltage-gated channel, subfamily G, member 4 - membrane-bound transcription factor peptidase, site 1 |