Cart 45 Product Products 5 279,76 € (empty)
-
1 x C11orf67-c...113,40 € -
1 x MDP-1-magn...113,40 € -
1 x PTS-6-pyru...113,40 € -
1 x PARP6-poly...121,50 € -
-
1 x LST1-leuko...113,40 € -
1 x BEX5-brain...113,40 € -
-
-
1 x FTL-ferrit...113,40 € -
1 x SPATA3-spe...113,40 € -
1 x C16orf65-c...113,40 € -
1 x TRIM31-tri...113,40 € -
1 x EIF3E-euka...121,50 € -
1 x WBP2NL-WBP...113,40 € -
1 x KIR2DL1-ki...121,50 € -
1 x NDUFB1-NAD...113,40 € -
-
1 x C19orf34-c...113,40 € -
-
1 x TCN2-trans...121,50 € -
1 x NECAP1-NEC...113,40 € -
1 x IL21-inter...113,40 € -
-
1 x PRKAG2-pro...121,50 € -
1 x GABRA2-gam...121,50 € -
1 x NDRG1-N-my...113,40 € -
1 x XCL2-chemo...113,40 € -
1 x TMSB4X-thy...113,40 € -
-
-
1 x PRDX3-pero...113,40 € -
1 x SMNDC1-sur...113,40 € -
1 x DBNL-drebr...121,50 € -
1 x FBXO46-F-b...121,50 € -
1 x FAM19A4-fa...113,40 € -
1 x ASB9-ankyr...121,50 € -
1 x GLB1L-gala...121,50 € -
1 x Goat...225,00 € -
-
-
1 x FAM20A-fam...113,40 € -
1 x C10orf32-c...113,40 € -
1 x RPRD1A-reg...121,50 € -
No products
To be determined Shipping
5 279,76 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 45 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 279,76 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 279,76 €
View larger 
Data sheet of ZACN-zinc activated ligand-gated ion channel Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZACN-zinc activated ligand-gated ion channel Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC110597 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZACN |
| Origin species: | Human |
| Product name: | ZACN-zinc activated ligand-gated ion channel Gene |
| Size: | 2ug |
| Accessions: | BC110597 |
| Gene id: | 353174 |
| Gene description: | zinc activated ligand-gated ion channel |
| Synonyms: | LGICZ; LGICZ1; ZAC; ZAC1; zinc-activated ligand-gated ion channel; ligand-gated ion channel subunit; ligand-gated ion channel zinc-activated 1; ligand-gated ion-channel receptor L2; zinc activated ligand-gated ion channel 1; zinc activated ion channel |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctatggtccctgctccatctcaccttcctggggttcagcattaccttgctgttggtccacgggcagggcttccaagggacagcagccatctggccatccctcttcaacgtcaacttgtccaagaaggttcaggaaagcatccagatcccgaacaatgggagtgcgcccctgctcgtggatgtgcgggtgtttgtctccaacgtgtttaatgtggacatcctgcgatacacaatgtcctccatgctgctgcttaggctgtcctggctggacactcgcctggcctggaacactagtgcacacccgcggcacgccatcacgctgccctgggagtctctctggacaccaaggctcaccatcctggaggcgctctgggtggactggagggaccagagcccccaggctcgagtagaccaggacggccacgtgaagctcaacctggccctcaccacggagaccaactgcaactttgagctcctccacttcccccgggaccacagcaactgcagcctcagcttctacgctctcagcaacacggcgatggagttagagttccaggcccacgtggtgaacgagattgtgagtgtcaagagggaatacgtagtttatgatctgaagacccaagtcccaccccagcagctggtgccctgcttccaggtgacgctgaggctgaagaacacggcgctcaagtccatcatcgctctcttggtgcctgcagaggcactgctgttggctgacgtgtgcggggggttgctgcccctccgggccattgagcgcataggctacaaggtgacattgctgctgagttacctcgtcctccactcctccctggtgcaggccctgcccagctcctcctcctgcaacccactgctcatttactacttcaccatcctgctgctgctgctcttcctcagcaccatagagactgtgctgctggctgggctgctggcccggggcaaccttggggccaagagcggccccagcccagccccgagaggggaacagcgagagcacggcaacccagggcctcatcctgctgaagagccctccagaggagtaaaggggtcacagagaagctggcctgagactgctgaccgcatcttcttcctcgtgtatgtggttggggtgctgtgcacccaattcgtctttgcaggaatctggatgtgggcagcgtgcaagtctgacgcagcccctggagaggctgcaccccatggcaggcggcctagactgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 38, member 11 - chromosome 14 open reading frame 39 - component of oligomeric golgi complex 8 - chromosome 10 open reading frame 68 |