Cart 15 Product Products 2 174,91 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 € -
1 x PLA2G2D-ph...113,40 € -
1 x C20orf177-...121,50 € -
1 x WDR53-WD...121,50 € -
1 x CCL22-chem...113,40 €
No products
To be determined Shipping
2 174,91 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 174,91 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 174,91 €
View larger 
Data sheet of RHBDL1-rhomboid, veinlet-like 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHBDL1-rhomboid, veinlet-like 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC120874 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHBDL1 |
| Origin species: | Human |
| Product name: | RHBDL1-rhomboid, veinlet-like 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC120874 |
| Gene id: | 9028 |
| Gene description: | rhomboid, veinlet-like 1 (Drosophila) |
| Synonyms: | RHBDL; RRP; rhomboid-related protein 1; rhomboid, drosophila, homolog of; rhomboid, veinlet-like 1; rhomboid-like protein 1; rhomboid like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtagggtggaagacgggggaacaactgaggagctggaggactgggacccaggcaccagtgccctgccagctcctgggatcaagcagggtcccagggaacagacaggcacggggcccctgtcccaaaagtgctgggagcctgagcctgatgctcccagccagcctggcccagccctttggtccaggggtcgggcccgcactcaggccttggctggcggctcctcactgcagcagctggaccccgagaacacaggcttcatcggtgcggacaccttcactggcctggtgcacagccatgagctgcccctggacccggccaagctggacatgctggtggccctggctcagagcaacgagcagggccaggtctgctaccaggagctggtggacctgatcagcagcaagcgctccagcagtttcaagcgggccattgctaacggacagcgggcactgccccgggacgggccgctggatgagccaggcctaggtgtctacaagcggtttgtgcgttacgtggcctacgagatcctgccttgtgaggtggaccgccgctggtacttctaccgtcaccgcagctgcccaccccccgtgttcatggcctcggtcactcttgcccagatcatcgtgttcctgtgttacggggcccgcctcaacaagtgggtgctgcagacctaccaccccgagtacatgaagagcccccttgtgtaccaccccgggcaccgtgcccgcgcctggcgcttcctcacctacatgttcatgcacgttgggctggagcagctggggttcaacgccctcctgcagctgatgatcggggtgcccctggagatggtgcacggcctgctccgcatcagcctgctctacctggcaggcgtgctggcaggctccctaaccgtctccatcaccgacatgcgggccccggtggtgggaggctccggcggggtctacgccctgtgctcggcacacctggccaacgttgtcatgaactgggctgggatgagatgtccctacaagttgctgaggatggtgctggccttggtgtgcatgagctccgaggtgggccgggccgtgtggctgcgcttctccccgccgctgcccgcctcgggcccacagcccagcttcatggcgcacctggcaggcgcggtggtgggggtgagcatgggcctgaccatcctgcggagctacgaggagcgcctgcgggaccagtgcggctggtgggtggtgctgctggcctacggcaccttcctgctcttcgccgtcttctggaacgtcttcgcctacgacctgctgggcgcccacatccccccaccgccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc activated ligand-gated ion channel - solute carrier family 38, member 11 - chromosome 14 open reading frame 39 - component of oligomeric golgi complex 8 |