Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP4R1L-protein phosphatase 4, regulatory subunit 1-like Gene
PTXBC100979
New product
Data sheet of PPP4R1L-protein phosphatase 4, regulatory subunit 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP4R1L-protein phosphatase 4, regulatory subunit 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100979 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP4R1L |
| Origin species: | Human |
| Product name: | PPP4R1L-protein phosphatase 4, regulatory subunit 1-like Gene |
| Size: | 2ug |
| Accessions: | BC100979 |
| Gene id: | 55370 |
| Gene description: | protein phosphatase 4, regulatory subunit 1-like |
| Synonyms: | Ppp4r1l; 2310022O21Rik; 2700018L24Rik; C030004A17Rik; protein FAM118B; family with sequence similarity 118, member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagatccccctgtactttgtggacttgcaggatgacttagacgactatggatttgaagactatggtacagattgcgacaacatgagagtaacggccttcttggacattccaggccaggataacctgcctccactcactcgcctggagaagtatgctttcagcgagaacaccttcaaccggcagattattgccagagggctgcttgatatcttccgggacttcggtaacaatgaagaagacttcctcacggtaatggagattgtagtcagattgtcagaagatgcagagcccacagtgcggactgagctgatggaacagattcctcctattgccatttttttacaagaaaacagatcaaattttccagtggtgctctctgaatatctcatacctattgtagtgaggtacctcacagatccaaacaatcagataatctgcaaaatggcttcaatgctgagtaagagtaccgttgaacgcctgctactcccccgattctgtgaactgtgtggtgacaggaagctctttcaagttcggaaggtttgtgctgcaaattttggtgatatttgtcatgctgttggacaagaagccactgagaaatttttgatcccaaagttctttgagctctgctctgatgctgtttggggcatgcggaaagcctgtgcagaatgcttcacggctgtgtcgcacagctcctcccctggggtccgcagaacccagctcttcccgctcttcatcagacttgtcagcgacccctgccgatgggtgcaccaggctgccttccagtccctcggccccttcacttccacctctgcaaacccctccagggctggcctttatcttcgagaggatggcgccctgagcatctggccactcacccaggatttggactctggttttgcctctggctcccctgctcccagcagtggtggtaacacttcccctgccagtttaactcgttcagcaaagcctgtgcggagcgagccagagctacctgtggaagggacctcagcgaaaaccagtgattgcccacacagcagtagctcctctgacggcccagcggaaagccctgtggaaagctgtgtgtcggctggagctgagtggaccagggtttccccagagaccagcgcctgctcaaagctttctgacatgaatgacctccccatcagcagctaccctggatcagattcctgggcctgcccagggaacactgaggatgtgttcagtcattttctttattggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TBC1 domain family, member 8B (with GRAM domain) - acyl-CoA synthetase medium-chain family member 2A - TBC1 domain family, member 9B (with GRAM domain) - alanyl-tRNA synthetase 2, mitochondrial (putative) |