Cart 2 Product Products 234,90 € (empty)
-
1 x GCAT-glyci...121,50 € -
1 x MGC5590-hy...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
Data sheet of ESSPL-epidermis-specific serine protease-like protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ESSPL-epidermis-specific serine protease-like protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121109 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ESSPL |
| Origin species: | Human |
| Product name: | ESSPL-epidermis-specific serine protease-like protein Gene |
| Size: | 2ug |
| Accessions: | BC121109 |
| Gene id: | 345062 |
| Gene description: | epidermis-specific serine protease-like protein |
| Synonyms: | ESSPL; serine protease 48; epidermis-specific serine protease-like protein; testicular tissue protein Li 65; protease, serine 48 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggccctgctggctgtgccttcacgctgctccttctgctggggatctcagtgtgtgggcaacctgtatactccagccgcgttgtaggtggccaggatgctgctgcagggcgctggccttggcaggtcagcctacactttgaccacaactttatctatggaggttccctcgtcagtgagaggttgatactgacagcagcacactgcatacaaccgacctggactactttttcatatactgtgtggctaggatcgattacagtaggtgactcaaggaaacgtgtgaagtactacgtgtccaaaatcgtcatccatcccaagtaccaagatacaacggcagacgtcgccttgttgaaactgtcctctcaagtcaccttcacttctgccatcctgcctatttgcttgcccagtgtcacaaagcagttggcaattccacccttttgttgggtgaccggatggggaaaagttaaggaaagttcagatagagattaccattctgcccttcaggaagcagaagtacccattattgaccgccaggcttgtgaacagctctacaatcccatcggtatcttcttgccagcactggagccagtcatcaaggaagacaagatttgtgctggtgatactcaaaacatgaaggatagttgcaagggtgattctggagggcctctgtcgtgtcacattgatggtgtatggatccagacaggagtagtaagctggggattagaatgtggtaaatctcttcctggagtctacaccaatgtaatctactaccaaaaatggattaatgccactatttcaagagccaacaatctagacttctctgacttcttgttccctattgtcctactctctctggctctcctgtgtccctcctgtgcctttggacctaacactatacacagagtaggcactgtagctgaagctgttgcttgcatacagggctgggaagagaatgcatggagatttagtcccaggggcagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear receptor subfamily 5, group A, member 2 - kelch repeat and BTB (POZ) domain containing 5 - family with sequence similarity 135, member A - phosphodiesterase 6A, cGMP-specific, rod, alpha |