Cart 1 Product Products 113,40 € (empty)
-
1 x ZC4H2-zinc...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
OR3A1-olfactory receptor, family 3, subfamily A, member 1 Gene
PTXBC096187
New product
Data sheet of OR3A1-olfactory receptor, family 3, subfamily A, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR3A1-olfactory receptor, family 3, subfamily A, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096187 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR3A1 |
| Origin species: | Human |
| Product name: | OR3A1-olfactory receptor, family 3, subfamily A, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC096187 |
| Gene id: | 4994 |
| Gene description: | olfactory receptor, family 3, subfamily A, member 1 |
| Synonyms: | OLFRA03; OR17-40; OR17-82; OR40; olfactory receptor 3A1; olfactory receptor 17-40; olfactory receptor OR17-15; olfactory receptor family 3 subfamily A member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagccagaatctggggccaatggaacagtcattgctgagttcatcctgctgggcttgctggaggcgccagggctgcagccagttgtctttgtgctcttcctctttgcctacctggtcacggtcaggggcaacctcagcatcctggcagctgtcttggtggagcccaaactccacacccccatgtacttcttcctggggaacctatcagtgctggatgttgggtgcatcagcgtcactgttccatcaatgttgagtcgtctcctgtcccgcaagcgtgcagttccctgtggggcctgccttacccagctcttcttcttccatctgttcgttggagtggactgcttcctgctgaccgccatggcctatgaccgattcctggccatctgccggcccctcacctacagcacccgcatgagtcagacagtccagaggatgttggtggctgcgtcctgggcttgtgctttcaccaacgcactgacccacactgtggccatgtccacgctcaacttctgtggccccaatgtgatcaatcacttctactgtgacctcccacagctcttccagctctcctgctccagcacccaactcaatgagctgctgctttttgctgtgggttttataatggcaggtacccccatggctctcattgtcatctcctatatccacgtggcagctgcagtcctgcgaattcgctctgtagagggcaggaagaaagccttctccacatgtggctcccacctcactgtggttgccatattctatggttcaggtatctttaactatatgcgactgggttcaaccaagctttcagacaaggataaagctgttggaattttcaacactgtcatcaatcccatgctgaacccaatcatctacagcttcagaaaccctgatgtgcagagtgccatctggaggatgctcacagggaggcggtcactggcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-aminobutyric acid (GABA) A receptor, alpha 6 - glucose-fructose oxidoreductase domain containing 1 - ribosomal protein S6 kinase, 90kDa, polypeptide 3 - roundabout homolog 4, magic roundabout (Drosophila) |