Cart 4 Product Products 451,08 € (empty)
-
1 x DUSP3-dual...113,40 € -
1 x EFCAB1-EF-...113,40 € -
-
1 x OR2K2-olfa...121,50 €
No products
To be determined Shipping
451,08 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 451,08 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 451,08 €
Data sheet of TMEM185A-transmembrane protein 185A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM185A-transmembrane protein 185A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103821 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM185A |
| Origin species: | Human |
| Product name: | TMEM185A-transmembrane protein 185A Gene |
| Size: | 2ug |
| Accessions: | BC103821 |
| Gene id: | 84548 |
| Gene description: | transmembrane protein 185A |
| Synonyms: | CXorf13; FRAXF; ee3; transmembrane protein 185A; family with sequence similarity 11, member A; fragile site, folic acid type, rare, fra(X)(q28) F |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacctgaggggcctcttccaggacttcaacccgagtaaattcctcatctatgcctgtctgctgctgttctctgtgctgctggcccttcgtttggatggcatcatacagtggagttactgggctgtctttgctccaatatggctgtggaagttaatggtcattgttggagcctcagttggaactggagtctgggcacgaaatcctcaatatcgagcagaaggagaaacgtgtgtggagtttaaagccatgttgattgcagtgggcatccacttgctcttgttgatgtttgaagttctggtctgtgacagaatcgagagaggaagccatttctggctcctggtcttcatgccgctgttctttgtttccccggtgtctgttgcagcttgcgtttggggctttcgacatgacaggtcactagagttagaaatcctgtgttctgtcaacattctccagtttatattcattgccttaagactggacaagatcatccactggccctggcttgttgtgtgtgtcccgctgtggattctcatgtcctttctgtgcctggtggtcctctactacattgtgtggtccgtcttgttcttgcgctctatggatgtgattgcggagcagcgcaggacacacataaccatggccctgagctggatgaccatcgtcgtgccccttcttacatttgagattctgctggttcacaaactggatggccacaacgccttctcctgcatcccgatctttgtccccctttggctctcgttgatcacgctgatggcaaccacatttggacagaagggaggaaaccactggtggtttggtatccgcaaagatttctgtcagtttctgcttgaaatcttcccatttctacgagaatatggaaacatttcctatgatctccatcacgaagataatgaagaaaccgaagagaccccagttccggagccccctaaaatcgcacccatgtttcgaaagaaggccagggtggtcattacccagagccctgggaagtatgtgctcccacctcccaaattaaatatcgaaatgccagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - rhomboid domain containing 1 - G protein-coupled receptor 39 - collagen, type VIII, alpha 2 - paraneoplastic antigen like 5 |