Cart 43 Product Products 5 420,25 € (empty)
-
1 x PHB2-prohi...121,50 € -
1 x C19orf57-c...121,50 € -
1 x SH3BGRL3-S...113,40 € -
1 x DUSP22-dua...113,40 € -
1 x BAT2L-HLA-...121,50 € -
1 x HSD17B10-h...113,40 € -
-
1 x NARF-nucle...121,50 € -
1 x C5orf24-ch...113,40 € -
1 x C1orf162-c...113,40 € -
1 x ATP5G3-ATP...113,40 € -
1 x CSTL1-cyst...113,40 € -
1 x CD79a...259,07 € -
1 x MLKL-mixed...113,40 € -
1 x C5orf33-ch...121,50 € -
1 x RBMY1A1-RN...121,50 € -
-
1 x SNHG11-sma...113,40 € -
1 x Goat...333,10 € -
1 x B3GALNT1-b...121,50 € -
1 x C1orf31-ch...113,40 € -
-
1 x SNX4-sorti...121,50 € -
1 x TCEAL8-tra...113,40 € -
1 x EIF4EBP2-e...113,40 € -
1 x LOC441251-...113,40 € -
1 x C1orf109-c...113,40 € -
1 x HMGN2-high...113,40 € -
1 x NPM1-nucle...121,50 € -
1 x NME5-non-m...113,40 € -
1 x ZNF213-zin...121,50 € -
1 x UBE2DNL-ub...113,40 € -
1 x LRFN4-leuc...121,50 € -
1 x PDCD6-prog...113,40 € -
1 x RNF25-ring...121,50 € -
1 x UBAC2-UBA...113,40 € -
-
-
1 x SCGB1D1-se...113,40 € -
1 x HAND1-hear...113,40 € -
1 x VCX3A-vari...113,40 € -
1 x DNAJB6-Dna...121,50 € -
1 x RNF14-ring...121,50 €
No products
To be determined Shipping
5 420,25 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 43 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 420,25 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 420,25 €
Data sheet of GPR120-G protein-coupled receptor 120 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR120-G protein-coupled receptor 120 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101175 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR120 |
| Origin species: | Human |
| Product name: | GPR120-G protein-coupled receptor 120 Gene |
| Size: | 2ug |
| Accessions: | BC101175 |
| Gene id: | 338557 |
| Gene description: | G protein-coupled receptor 120 |
| Synonyms: | GPR120; BMIQ10; GPR129; GT01; O3FAR1; PGR4; free fatty acid receptor 4; G-protein coupled receptor 120; G-protein coupled receptor 129; G-protein coupled receptor GT01; G-protein coupled receptor PGR4; omega-3 fatty acid receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccctgaatgcgcgcgggcagcgggcgacgcgcccttgcgcagcctggagcaagccaaccgcacccgctttcccttcttctccgacgtcaagggcgaccaccggctggtgctggccgcggtggagacaaccgtgctggtgctcatctttgcagtgtcgctgctgggcaacgtgtgcgccctggtgctggtggcgcgccgacgacgccgcggcgcgactgcctgcctggtactcaacctcttctgcgcggacctgctcttcatcagcgctatccctctggtgctggccgtgcgctggactgaggcctggctgctgggccccgttgcctgccacctgctcttctacgtgatgaccctgagcggcagcgtcaccatcctcacgctggccgcggtcagcctggagcgcatggtgtgcatcgtgcacctgcagcgcggcgtgcggggtcctgggcggcgggcgcgggcagtgctgctggcgctcatctggggctattcggcggtcgccgctctgcctctctgcgtcttcttccgagtcgtcccgcaacggctccccggcgccgaccaggaaatttcgatttgcacactgatttggcccaccattcctggagagatctcgtgggatgtctcttttgttactttgaacttcttggtgccaggactggtcattgtgatcagttactccaaaattttacagatcacaaaggcatcaaggaagaggctcacggtaagcctggcctactcggagagccaccagatccgcgtgtcccagcaggacttccggctcttccgcaccctcttcctcctcatggtctccttcttcatcatgtggagccccatcatcatcaccatcctcctcatcctgatccagaacttcaagcaagacctggtcatctggccgtccctcttcttctgggtggtggccttcacatttgctaattcagccctaaaccccatcctctacaacatgacactgtgcaggaatgagtggaagaaaattttttgctgcttctggttcccagaaaagggagccattttaacagacacatctgtcaaaagaaatgacttgtcgattatttctggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin folding cofactor E-like - G protein-coupled receptor 152 - TBC1 domain family, member 24 - asteroid homolog 1 (Drosophila) |