Cart 17 Product Products 2 282,07 € (empty)
-
1 x Syndecan-1...534,00 € -
-
-
1 x GGA1-golgi...113,40 € -
-
-
1 x AP1S3-adap...113,40 € -
1 x IFIT2-inte...121,50 € -
1 x APITD1-apo...113,40 € -
1 x APIP-APAF1...113,40 € -
-
-
-
1 x HEXIM2-hex...121,50 € -
1 x HCFC2-host...121,50 € -
1 x SETD8-SET...121,50 € -
No products
To be determined Shipping
2 282,07 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 282,07 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 282,07 €
Data sheet of SPRY4-sprouty homolog 4 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPRY4-sprouty homolog 4 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125095 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPRY4 |
| Origin species: | Human |
| Product name: | SPRY4-sprouty homolog 4 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC125095 |
| Gene id: | 81848 |
| Gene description: | sprouty homolog 4 (Drosophila) |
| Synonyms: | HH17; protein sprouty homolog 4; sprouty homolog 4; sprouty RTK signaling antagonist 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccccgatcccacagagcgcccccttgactcccaactcagtcatggtccagccccttcttgacagccggatgtcccacagccggctccagcacccactcaccatcctacccattgaccaggtgaagaccagccatgtggagaatgactacatagacaaccctagcctggccctgaccaccggcccaaagcggacccggggcggggccccagagctggccccgacgcccgcccgctgtgaccaggatgtcacccaccattggatctccttcagcgggcgccccagctctgtgagcagcagcagcagcacatcctctgaccaacggctcttagaccacatggcaccaccacccgtggctgaccaggcctcaccaagggctgtgcgcatccagcccaaggtggtccactgccagccgctggacctcaagggcccggcggtcccacccgagctggacaagcacttcttgctgtgcgaggcctgtgggaagtgtaaatgcaaggagtgtgcatccccccggacgttgccttcctgctgggtctgcaaccaggagtgcctgtgctcagcccagactctggtcaactatggcacgtgcatgtgtttggtgcagggcatcttctaccactgcacgaatgaggacgatgagggctcctgcgctgaccacccctgctcctgctcccgctccaactgctgcgcccgctggtccttcatgggtgctctctccgtggtgctgccctgcctgctctgctacctgcctgccaccggctgcgtgaagctggcccagcgtggctacgaccgtctgcgccgccctggttgccgctgcaagcacacgaacagcgtcatctgcaaagcagccagcggggatgccaagaccagcaggcccgacaagcctttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (DNA directed), beta - deafness, autosomal dominant 5 - growth differentiation factor 9 - interleukin 1 receptor-like 2 |