Cart 36 Product Products 5 074,65 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
-
1 x RPL7L1-rib...113,40 € -
1 x SLP-76...259,07 € -
1 x COX11-COX1...121,50 € -
1 x C12orf10-c...121,50 € -
1 x VDAC3-volt...121,50 € -
1 x Septin 2...259,07 € -
-
-
1 x PLD4-phosp...121,50 € -
1 x CXCL13-che...113,40 € -
1 x COL20A1-co...113,40 € -
1 x LRRC14-leu...121,50 € -
1 x PPAP2B-pho...121,50 € -
1 x MXD3-MAX...113,40 € -
1 x VASP-vasod...121,50 € -
-
-
-
1 x C9orf61-ch...121,50 € -
-
1 x NIPSNAP3A-...113,40 € -
1 x FICD-FIC...121,50 € -
1 x KDELR3-KDE...113,40 € -
1 x TMEM30A-tr...121,50 € -
1 x RAB13-RAB1...113,40 € -
1 x Phospho-c-...259,07 €
No products
To be determined Shipping
5 074,65 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 36 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 074,65 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 074,65 €
View larger 
OR5L1-olfactory receptor, family 5, subfamily L, member 1 Gene
PTXBC109249
New product
Data sheet of OR5L1-olfactory receptor, family 5, subfamily L, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR5L1-olfactory receptor, family 5, subfamily L, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109249 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR5L1 |
| Origin species: | Human |
| Product name: | OR5L1-olfactory receptor, family 5, subfamily L, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC109249 |
| Gene id: | 219437 |
| Gene description: | olfactory receptor, family 5, subfamily L, member 1 |
| Synonyms: | OR11-151; OST262; olfactory receptor 5L1; olfactory receptor OR11-151; olfactory receptor, family 5, subfamily L, member 1; olfactory receptor family 5 subfamily L member 1 (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcaaggaaaactgcaccactgtggctgagttcattctccttggactatcagatgtccctgagttgagagtctgcctcttcctgctgttccttctcatctatggagtcacgttgttagccaacctgggcatgattgcactgattcaggtcagctctcggctccacacccccatgtactttttcctcagccacttgtcctctgtagatttctgctactcctcaataattgtgccaaaaatgttggctaatatctttaacaaggacaaagccatctccttcctagggtgcatggtgcaattctacttgttttgcacttgtgtggtcactgaggtcttcctgctggccgtgatggcctatgaccgctttgtggccatctgtaaccctttgctatacacagtcaccatgtcttggaaggtgcgtgtggagctggcttcttgctgctacttctgtgggacggtgtgttctctgattcatttgtgcttagctcttaggatccccttctatagatctaatgtgattaaccactttttctgtgatctacctcctgtcttaagtcttgcttgctctgatatcactgtgaatgagacactgctgttcctggtggccactttgaatgagagtgttaccatcatgatcatcctcacctcctacctgctaattctcaccaccatcctgaagatgggctctgcagagggcaggcacaaagccttctccacctgtgcttcccacctcacagctatcactgtcttccatggaacagtcctttccatttattgcaggcccagttcaggcaatagtggagatgctgacaaagtggccaccgtgttctacacagtcgtgattcctatgctgaactctgtgatctacagcctgagaaataaagatgtgaaagaagctctcagaaaagtgatgggctccaaaattcactcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 1, subfamily E, member 2 - olfactory receptor, family 1, subfamily D, member 2 - olfactory receptor, family 3, subfamily A, member 1 - gamma-aminobutyric acid (GABA) A receptor, alpha 6 |