Cart 28 Product Products 4 952,31 € (empty)
-
1 x SLC25A23-s...121,50 € -
1 x Phocein...259,07 € -
1 x APOL6-apol...121,50 € -
1 x BPESC1-ble...113,40 € -
1 x LigaTrap...984,64 € -
1 x NSFL1C-NSF...121,50 € -
1 x TINF2-TERF...121,50 € -
1 x MXD4-MAX...113,40 € -
1 x FOXN3-fork...113,40 € -
1 x LOH3CR2A-l...113,40 € -
1 x RHOJ-ras...113,40 € -
1 x SLC29A1-so...121,50 € -
1 x ENPP5-ecto...121,50 € -
1 x SLC23A3-so...121,50 € -
1 x AQP10-aqua...121,50 € -
1 x PRAMEF5-PR...121,50 € -
1 x MAPRE1-mic...121,50 € -
1 x Apoptosis...744,00 € -
1 x CA1-carbon...113,40 € -
1 x DUS2L-dihy...121,50 € -
1 x RIPPLY1-ri...113,40 € -
1 x CAV3-caveo...113,40 € -
1 x GCNT2-gluc...121,50 € -
1 x PPP2R3C-pr...121,50 € -
1 x DCTN1-dyna...113,40 € -
1 x AQP11-aqua...121,50 € -
1 x AQP9-aquap...121,50 € -
1 x UBR7-ubiqu...121,50 €
No products
To be determined Shipping
4 952,31 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 28 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 952,31 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 952,31 €
Data sheet of GPR68-G protein-coupled receptor 68 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR68-G protein-coupled receptor 68 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096071 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR68 |
| Origin species: | Human |
| Product name: | GPR68-G protein-coupled receptor 68 Gene |
| Size: | 2ug |
| Accessions: | BC096071 |
| Gene id: | 8111 |
| Gene description: | G protein-coupled receptor 68 |
| Synonyms: | AI2A6; GPR12A; OGR1; ovarian cancer G-protein coupled receptor 1; ovarian cancer G protein-coupled receptor, 1; sphingosylphosphorylcholine receptor; G protein-coupled receptor 68 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggagtgtggccccttcaggcccaaagatggggaacatcactgcagacaactcctcgatgagctgtaccatcgaccataccatccaccagacgctggccccggtggtctatgttaccgtgctggtggtgggcttcccggccaactgcctgtccctctacttcggctacctgcagatcaaggcccggaacgagctgggcgtgtacctgtgcaacctgacggtggccgacctcttctacatctgctcgctgcccttctggctgcagtacgtgctgcagcacgacaactggtctcacggcgacctgtcctgccaggtgtgcggcatcctcctgtacgagaacatctacatcagcgtgggcttcctctgctgcatctccgtggaccgctacctggctgtggcccatcccttccgcttccaccagttccggaccctgaaggcggccgtcggcgtcagcgtggtcatctgggccaaggagctgctgaccagcatctacttcctgatgcacgaggaggtcatcgaggacgagaaccagcaccgcgtgtgctttgagcactaccccatccaggcatggcagcgcgccatcaactactaccgcttcctggtgggcttcctcttccccatctgcctgctgctggcgtcctaccagggcatcctgcgcgccgtgcgccggagccacggcacccagaagagccgcaaggaccagatccagcggctggtgctcagcaccgtggtcatcttcctggcctgcttcctgccctaccacgtgttgctgctggtgcgcagcgtctgggaggccagctgcgacttcgccaagggcgttttcaacgcctaccacttctccctcctgctcaccagcttcaactgcgtcgccgaccccgtgctctactgcttcgtcagcgagaccacccaccgggacctggcccgcctccgcggggcctgcctggccttcctcacctgctccaggaccggccgggccagggaggcctacccgctgggtgcccccgaggcctccgggaaaagcggggcccagggtgaggagcccgagctgttgaccaagctccacccggccttccagacccctaactcgccagggtcgggcgggttccccacgggcaggttggcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2-like 12 (proline rich) - transmembrane protein 185A - rhomboid domain containing 1 - G protein-coupled receptor 39 |