Cart 1 Product Products 113,40 € (empty)
-
1 x SDC4-synde...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of DPH1-DPH1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DPH1-DPH1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096088 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DPH1 |
| Origin species: | Human |
| Product name: | DPH1-DPH1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC096088 |
| Gene id: | 1801 |
| Gene description: | DPH1 homolog (S. cerevisiae) |
| Synonyms: | DPH1 homolog; DEDSSH; DPH2L; DPH2L1; OVCA1; diphthamide biosynthesis protein 1; DPH-like 1; DPH2-like 1; candidate tumor suppressor in ovarian cancer 1; diphthamide biosynthesis protein 2 homolog-like 1; diptheria toxin resistance protein required for diphthamide biosynthesis (Saccharomyces)-like 1; ovarian cancer-associated gene 1 protein; ovarian tumor suppressor candidate 1; diphthamide biosynthesis 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacacctcggcccaagacttccgggtgctgtacgtctttgtggacatccggatagacactatacacctcctggactctctccgcctcacctttcccccagccactgcccttgccctggtcagcaccattcagtttgtgtcgaccttgcaggcagccgcccaggagctgaaagccgagtatcgtgtgagtgtcccacagtgcaagcccctgtcccctggagagatcctgggctgcacatccccccgactgtccaaagaggtggaggccgttgtgtatcttggagatggccgcttccatctggagtctgtcatgattgccaaccccaatgtccccgcttaccggtatgacccatatagcaaagtcctatccagagaacactatgaccaccagcgcatgcaggctgctcgccaagaagccatagccactgcccgctcagctaagtcctggggccttattctgggcactttgggccgccagggcagtcctaagatcctggagcacctggaatctcgactccgagccttgggcctttcctttgtgaggctgctgctctctgagatcttccccagcaagcttagcctacttcccgaggtggatgtgtgggtgcaggtggcatgtccacgtctctccattgactggggcacagccttccccaagccgctgctgacaccctatgaggcggccgtggctctgagggacatttcctggcagcagccctacccgatggacttctacgctggcagctccttggggccctggacggtgaaccacggccaggaccgccgtccccacgccccgggccggcccgcgcgggggaaggtgcaggaggggtccgcgcgtcccccttcggccgtggcttgcgaggactgcagctgcagggacgagaaggtggcgccgctggctccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromodomain protein, Y-like - bone morphogenetic protein 3 - transmembrane protein 87B - kelch-like 28 (Drosophila) |