Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of H1FNT-H1 histone family, member N, testis-specific Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about H1FNT-H1 histone family, member N, testis-specific Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC118635 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | H1FNT |
| Origin species: | Human |
| Product name: | H1FNT-H1 histone family, member N, testis-specific Gene |
| Size: | 2ug |
| Accessions: | BC118635 |
| Gene id: | 341567 |
| Gene description: | H1 histone family, member N, testis-specific |
| Synonyms: | H1.7; testis-specific H1 histone; HANP1; haploid germ cell-specific nuclear protein 1; histone H1t2; testis secretory sperm-binding protein Li 223n; H1 histone family member N, testis specific |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacaggccttgactggtgaggcccaaagccggtggccccgcagaggcgggagtggggccatggctgaggcgcctgggcccagtggcgaatcccgaggacactcagccactcagctgccagcggaaaaaactgtcgggggaccatcgaggggctgctcaagctccgtgctcagagtgtcccagttggtgctccaggccatctccactcacaaagggctgactctggcagctctcaagaaggagctccgaaacgccggctacgaagtgcgcaggaagagcggccgccacgaagcgcccagggggcaggccaaggccacgctcctccgggtcagcggcagcgacgccgccggctacttcagggtctggaaggttcccaagcccaggagaaagccgggacgcgcgaggcaagaggagggcacgcgcgctccctggaggaccccagccgcgccccggagctcccggaggcgccgccagccccttcgcaaggcggccaggaaggccagagaagtgtggagacagaacgcgagggcgaaagccaaggccaatgccagggcgaggaggaccaggagggcaaggccgagagccaaggagccgccgtgtgccagagccaaggaggaagcgggagcgacagcggcagacgaggggcgaggacaggccgtgaaggaagacaccacgccgaggtcagggaatgacaagaggcgaagctccaagcccagggaagagaagcaggagcccaagaagcccgcacagcggaccatccagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heterogeneous nuclear ribonucleoprotein A1 - v-akt murine thymoma viral oncogene homolog 2 - inositol polyphosphate-5-phosphatase, 40kDa - synovial sarcoma translocation, chromosome 18 |