Cart 30 Product Products 3 667,04 € (empty)
-
1 x TAF11-TAF1...113,40 € -
1 x NDFIP1-Ned...113,40 € -
1 x PHKG2-phos...121,50 € -
1 x CNBP-CCHC-...113,40 € -
1 x Laminin...259,07 € -
1 x GOLM1-golg...121,50 € -
1 x RAB35-RAB3...113,40 € -
1 x RPS19-ribo...113,40 € -
1 x RQCD1-RCD1...113,40 € -
1 x PEX10-pero...121,50 € -
1 x CBX8-chrom...121,50 € -
1 x GPER-G...121,50 € -
1 x PPIAL4G-pe...113,40 € -
1 x GPM6B-glyc...121,50 € -
1 x PCTK3-PCTA...121,50 € -
1 x RGS20-regu...113,40 € -
-
1 x RNF212-rin...121,50 € -
1 x CDA-cytidi...113,40 € -
1 x PAK1IP1-PA...121,50 € -
1 x COQ7-coenz...113,40 € -
-
1 x LOC339535-...113,40 € -
1 x FBXO32-F-b...113,40 € -
1 x MAGEB10-me...121,50 € -
-
1 x TUSC4-tumo...121,50 € -
1 x TIRAP-toll...113,40 € -
1 x ACOT1-acyl...121,50 € -
1 x PGD-phosph...121,50 €
No products
To be determined Shipping
3 667,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 30 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 667,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 667,04 €
Data sheet of CLDN23-claudin 23 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLDN23-claudin 23 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125148 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLDN23 |
| Origin species: | Human |
| Product name: | CLDN23-claudin 23 Gene |
| Size: | 2ug |
| Accessions: | BC125148 |
| Gene id: | 137075 |
| Gene description: | claudin 23 |
| Synonyms: | CLDNL; hCG1646163; claudin-23; 2310014B08Rik; claudin 23 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggacgccggtggtgatgacgctgggcatggtgttggcgccctgcgggctcctgctcaacctgaccggcaccctggcgcccggctggcggctggtgaagggcttcctgaaccagccagtggacgtggagttgtaccagggcctgtgggacatgtgtcgcgagcagagcagccgcgagcgcgagtgcggccagacggaccagtggggctacttcgaggcccagcccgtgctggtggcgcgggcactcatggtcacctcgctggccgccacggtcctggggcttctgctggcgtcgctgggcgtgcgctgctggcaggacgagcccaacttcgtgctggcagggctctcgggcgtcgtgctcttcgtcgctggcctcctcggcctcatcccggtgtcctggtacaaccacttcttgggggaccgcgacgtgctgcccgccccggccagcccggtcacggtgcaggtcagctacagcctggtcctgggctacctgggcagctgcctcctgctgctgggcggcttctcgctggcgctcagcttcgcgccctggtgcgacgagcgttgtcgccgccgccgcaagggaccctccgccgggcctcgccgcagcagcgtcagcaccatccaagtggagtggcccgagcccgacctggcgcccgccatcaagtactacagcgacggccagcaccgaccgccgcctgcccagcaccgcaagcccaagcccaagcccaaggtcggcttccccatgccgcggccgcggcccaaggcctacaccaactcggtggacgtcctcgacggggaggggtgggagtcccaggacgctccctcgtgcagcacccacccctgcgacagctcgctgccctgcgactccgacctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - paired box 3 - copine VIII - paired box 7 - KIAA1383 |