Cart 6 Product Products 694,08 € (empty)
-
1 x C15orf5-ch...113,40 € -
1 x C5orf45-ch...121,50 € -
1 x SMYD1-SET...121,50 € -
1 x ATP5L-ATP...113,40 € -
1 x HNRPDL-het...121,50 € -
No products
To be determined Shipping
694,08 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 694,08 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 694,08 €
Data sheet of HOXB1-homeobox B1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HOXB1-homeobox B1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096192 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HOXB1 |
| Origin species: | Human |
| Product name: | HOXB1-homeobox B1 Gene |
| Size: | 2ug |
| Accessions: | BC096192 |
| Gene id: | 3211 |
| Gene description: | homeobox B1 |
| Synonyms: | HCFP3; HOX2; HOX2I; Hox-2.9; homeobox protein Hox-B1; homeobox protein Hox-2I; homeobox B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactataataggatgaactccttcttagagtacccactctgtaaccggggacccagcgcctacagcgcccacagcgcccacagcgccccaacctcctttcccccaagctcggctcaggcggttgacagctatgcaagcgagggccgctacggtggggggctgtccagccctgcgtttcagcagaactccggctatcccgcccagcagccgccttcgaccctgggggtgcccttccccagctctgcgccctcggggtatgctcctgccgcctgcagccccagctacgggccttctcagtactaccctctgggtcattcagaaggagacggaggctattttcatccctcgagctacggggcccagctagggggcttgtccgatggctacggagcaggtggagccggtccggggccatatcctccgcagcatcccccttatgggaacgagcagaccgcaagctttgcaccggcctatgctgatctcctctccgaggacaaggaaacaccctgcccttcagaacctaacacccccacggcccggaccttcgactggatgaaggttaagagaaacccacccaagacaggtagggctcagatgtggccaccccttctccggggcccaaagcatctctgcttcccctgcagtgacatgtcctgggtctgggctgggttcttctctttcagcggctctggtagacacaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - claudin 23 - paired box 3 - copine VIII - paired box 7 |