Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MUC1-mucin 1, cell surface associated Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MUC1-mucin 1, cell surface associated Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC120975 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MUC1 |
| Origin species: | Human |
| Product name: | MUC1-mucin 1, cell surface associated Gene |
| Size: | 2ug |
| Accessions: | BC120975 |
| Gene id: | 4582 |
| Gene description: | mucin 1, cell surface associated |
| Synonyms: | MUC1/ZD; ADMCKD; ADMCKD1; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC; MUC-1/X; PEM; PEMT; PUM; mucin-1; H23 antigen; breast carcinoma-associated antigen DF3; cancer antigen 15-3; carcinoma-associated mucin; episialin; krebs von den Lungen-6; mucin 1, transmembrane; peanut-reactive urinary mucin; polymorphic epithelial mucin; tumor associated epithelial mucin; tumor-associated epithelial membrane antigen; mucin 1, cell surface associated |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacaccgggcacccagtctcctttcttcctgctgctgctcctcacagtgcttacagctaccacagcccctaaacccgcaacagttgttacgggttctggtcatgcaagctctaccccaggtggagaaaaggagacttcggctacccagagaagttcagtgcccagctctactgagaagaatgcttttaattcctctctggaagatcccagcaccgactactaccaagagctgcagagagacatttctgaaatgtttttgcagatttataaacaagggggttttctgggcctctccaatattaagttcaggccaggatctgtggtggtacaattgactctggccttccgagaaggtaccatcaatgtccacgacgtggagacacagttcaatcagtataaaacggaagcagcctctcgatataacctgacgatctcagacgtcagcgtgagtgatgtgccatttcctttctctgcccagtctggggctggggtgccaggctggggcatcgcgctgctggtgctggtctgtgttctggttgcgctggccattgtctatctcattgccttggctgtctgtcagtgccgccgaaagaactacgggcagctggacatctttccagcccgggatacctaccatcctatgagcgagtaccccacctaccacacccatgggcgctatgtgccccctagcagtaccgatcgtagcccctatgagaaggtttctgcaggtaatggtggcagcagcctctcttacacaaacccagcagtggcagccacttctgccaacttgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein-coupled receptor 141 - G protein-coupled receptor 120 - tubulin folding cofactor E-like - G protein-coupled receptor 152 |