Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MBL2-mannose-binding lectin (protein C) 2, soluble (opsonic defect) Gene
PTXBC096179
New product
Data sheet of MBL2-mannose-binding lectin (protein C) 2, soluble (opsonic defect) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MBL2-mannose-binding lectin (protein C) 2, soluble (opsonic defect) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096179 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MBL2 |
| Origin species: | Human |
| Product name: | MBL2-mannose-binding lectin (protein C) 2, soluble (opsonic defect) Gene |
| Size: | 2ug |
| Accessions: | BC096179 |
| Gene id: | 4153 |
| Gene description: | mannose-binding lectin (protein C) 2, soluble (opsonic defect) |
| Synonyms: | COLEC1; HSMBPC; MBL; MBL2D; MBP; MBP-C; MBP1; MBPD; mannose-binding protein C; collectin-1; mannan-binding lectin; mannose-binding lectin (protein C) 2, soluble (opsonic defect); mannose-binding lectin 2, soluble (opsonic defect); mannose binding lectin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccctgtttccatcactccctctccttctcctgagtatggtggcagcgtcttactcagaaactgtgacctgtgaggatgcccaaaagacctgccctgcagtgattgcctgtagctctccaggcatcaacggcttcccaggcaaagatgggcgtgatggcaccaagggagaaaagggggaaccaggccaagggctcagaggcttacagggcccccctggaaagttggggcctccaggaaatccagggccttctgggtcaccaggaccaaagggccaaaaaggagaccctggaaaaagtccggatggtgatagtagcctggctgcctcagaaagaaaagctctgcaaacagaaatggcacgtatcaaaaagtggctcaccttctctctgggcaaacaagttgggaacaagttcttcctgaccaatggtgaaataatgacctttgaaaaagtgaaggccttgtgtgtcaagttccaggcctctgtggccacccccaggaatgctgcagagaatggagccattcagaatctcatcaaggaggaagccttcctgggcatcactgatgagaagacagaagggcagtttgtggatctgacaggaaatagactgacctacacaaactggaacgagggtgaacccaacaatgctggttctgatgaagattgtgtattgctactgaaaaatggccagtggaatgacgtcccctgctccacctcccatctggccgtctgtgagttccctatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carcinoembryonic antigen-related cell adhesion molecule 21 - solute carrier organic anion transporter family, member 1B1 - ubiquitously transcribed tetratricopeptide repeat, X chromosome - ADAM metallopeptidase with thrombospondin type 1 motif, 12 |