No products
Prices are tax excluded
PTXBC118593
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC118593 |
Product type: | DNA & cDNA |
Ncbi symbol: | RP11-738I14.8 |
Origin species: | Human |
Product name: | RP11-738I14.8-FLJ46082 protein Gene |
Size: | 2ug |
Accessions: | BC118593 |
Gene id: | 389799 |
Gene description: | FLJ46082 protein |
Synonyms: | C9orf171; cilia- and flagella-associated protein 77; cilia and flagella associated protein 77 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgccagaggccaggagctccggcccggacctcacgcgatggaggaagcagcagcagcctgtgcgccgcacggtcagccaggtctgcccgcccccgcggcggcccctgaccgtggcggacatccgttccggcatggagaacgagcggctgggggtcgtgcgggactccatgtttcagaaccctctcatcgtcaaggctgaactcggcaagccccgggaaagaagctacagtctgcccggcattaattttaattatggactctacatccgagggcttgacggaggagtccctgaagccatcggacgctggaacgtgttcaagcagcagcccacctgcccccacgagctgacccggaattatatcgcaatgaaccgcggggcggtgaaagccggcctggtgactgcccgggagaacttgctctaccgtcagctcaatgacatccgcatcagtgaccaggatgaccggcgcatgaagaaagagccgccccctctccctccaaacatgacatttgggatccgggcacggccttccacacccttctttgatctgctgcagcaccggtacctgcagctgtgggtacaggaacaaaaggccacccagaaagccatcaaactggagaagaagcagaaggtggtccttgggaagctgtatgagacccggagcagtcagctgaggaagtacaagccgcccgtgaagctggacaccctctggcacatgcctcacttccagaaggtgggccgccaccttgatacgttccccacggaggccgatcgccagagagcattaaaagcccaccgggaagagtgtgccgtgcgccaggggaccctgcggatgggcaactacacccacccctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - zinc finger protein 586 - surfactant protein A1B - ring finger protein 151 - FtsJ homolog 2 (E. coli) |