Cart 4 Product Products 819,28 € (empty)
-
1 x C1orf49-ch...113,40 € -
-
1 x Ghrelin...474,00 € -
1 x C17orf66-c...113,40 €
No products
To be determined Shipping
819,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 819,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 819,28 €
Data sheet of KRTAP10-1-keratin associated protein 10-1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP10-1-keratin associated protein 10-1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC120959 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP10-1 |
| Origin species: | Human |
| Product name: | KRTAP10-1-keratin associated protein 10-1 Gene |
| Size: | 2ug |
| Accessions: | BC120959 |
| Gene id: | 386677 |
| Gene description: | keratin associated protein 10-1 |
| Synonyms: | KAP10.1; KAP18-1; KAP18.1; KRTAP10.1; KRTAP18-1; KRTAP18.1; keratin-associated protein 10-1; high sulfur keratin-associated protein 10.1; keratin-associated protein 10.1; keratin-associated protein 18-1; keratin-associated protein 18.1; keratin associated protein 10-1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccgcgtccaccatgtccgtctgctccagcgcttgctccgactcctggcaggtggatgcctgcccagagagctgctgtgagccccactgctgcgccctcagctgctgcgccctggccccctgcctgaccctggtctgcaccccagtgagccgtgtgtccagcccctgctgccaggcagcctgtgagcccagcccctgccaatcaggctgcaccagctcctgcacgccctcgtgctgccagcagtctagctgccagccggcttgctgcacctcctccccctgccagcaggcctgctgcatgcccgtctgctgcaagcctgtgtgctgcctgcccacctgctctaaggattcctcttcatgctgccagcagtctagctgccagccaacttgctgtgcctcttcctccagccagcagtcctgctgtgtgcctgtttgctgcaagcctgtgtgctatgtgcccacctgctctgagtcatcctcttcatgctgccagcagtctagctgccatccagcttgctgcacctcctccccctgccagcaggcctgctgcgtgcccgtccgttgcaagcctgtctgctgcaagcccatctgctgtgtgcccgtctgctctggggcttccacttcatgctgccagcagtctagctgtcagccggcttgctgcaccacctcctgctgcagaccctcctcctccgtgtccctcctctgccgccctgtatgccagcccgcctgctgtatgcctgtctcctcctgctgtgcccctgcctcctcctgccaggccagctgctgccgcccggcctcctgcgtgtccctcctctgccgccccgcgtgctcccgcctggcctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 10-5 - abhydrolase domain containing 12B - C-reactive protein, pentraxin-related - keratin associated protein 10-8 |