> >>SLMO1-slowmo homolog 1 (Drosophila) Gene
SLMO1-slowmo homolog 1 (Drosophila) Gene View larger

SLMO1-slowmo homolog 1 (Drosophila) Gene

PTXBC106750

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SLMO1-slowmo homolog 1 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLMO1-slowmo homolog 1 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC106750
Product type: DNA & cDNA
Ncbi symbol: SLMO1
Origin species: Human
Product name: SLMO1-slowmo homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC106750
Gene id: 10650
Gene description: slowmo homolog 1 (Drosophila)
Synonyms: SLMO1; C18orf43; HFL-EDDG1; PRELI domain containing protein 3A; erythroid differentiation and denucleation factor 1; protein slowmo homolog 1; slowmo homolog 1; PRELI domain containing 3A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatctggagctcggagcacgtgtttggccacccgtgggacacggtcatccaggcggccatgcgcaagtacccgaacccgatgaacccgagcgtgctgggcgtggatgtgctacagcgccgcgtggacggccgcggccgcctgcacagcttgcgcctgctcagcaccgagtgggggctgcccagcctcgtgagagcgattttgggaaccagtaggacattgacatacatccgagaacattctgtggtggatccagtggaaaagaaaatggaactttgttctaccaatatcacactcacaaatttggtgtcagttaatgagaggttggtgtacacacctcatccagagaacccagaaatgaccgtgctcacacaagaagccatcatcactgtgaaggggattagccttggtagttatttggaaagtttaatggccaatacgatatcatccaatgcaaagaaggggtgggctgctatcgagtggataattgaacactctgaaagcgctgtgagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuropeptides B/W receptor 1
- G protein-coupled receptor 68
- BCL2-like 12 (proline rich)
- transmembrane protein 185A

Reviews

Buy SLMO1-slowmo homolog 1 (Drosophila) Gene now

Add to cart