Cart 3 Product Products 346,94 € (empty)
-
-
1 x HMGA1-high...113,40 € -
1 x EPHX1-epox...121,50 €
No products
To be determined Shipping
346,94 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 346,94 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 346,94 €
Data sheet of CAV3-caveolin 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CAV3-caveolin 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC102036 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CAV3 |
| Origin species: | Human |
| Product name: | CAV3-caveolin 3 Gene |
| Size: | 2ug |
| Accessions: | BC102036 |
| Gene id: | 859 |
| Gene description: | caveolin 3 |
| Synonyms: | LGMD1C; LQT9; VIP-21; VIP21; caveolin-3; M-caveolin; cavolin 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggcagaagagcacacagatctcgaggcccagatcgtcaaggatatccactgcaaggagattgacctggtgaaccgagaccccaagaacattaacgaggacatagtcaaggtggattttgaagacgtgatcgcagagcctgtgggcacctacagctttgacggcgtgtggaaggtgagctacaccaccttcactgtctccaagtactggtgctaccgtctgttgtccacgctgctgggcgtcccactggccctgctctggggcttcctgttcgcctgcatctccttctgccacatctgggcggtggtgccatgcattaagagctacctgatcgagatccagtgcatcagccacatctactcactctgcatccgcaccttctgcaacccactcttcgcggccctgggccaggtctgcagcagcatcaaggtggtgctgcggaaggaggtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin M1 - cyclin T2 - exportin 6 - myocardin |