Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FKBP1A-FK506 binding protein 1A, 12kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKBP1A-FK506 binding protein 1A, 12kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119732 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKBP1A |
| Origin species: | Human |
| Product name: | FKBP1A-FK506 binding protein 1A, 12kDa Gene |
| Size: | 2ug |
| Accessions: | BC119732 |
| Gene id: | 2280 |
| Gene description: | FK506 binding protein 1A, 12kDa |
| Synonyms: | PPIase FKBP1A; peptidyl-prolyl cis-trans isomerase FKBP1A; FKBP-12; FKBP-1A; FKBP1; PKC12; PKCI2; PPIASE; 12 kDa FK506-binding protein; 12 kDa FKBP; FK506 binding protein 1A, 12kDa; FK506 binding protein12; FK506-binding protein 1; FK506-binding protein 12; FK506-binding protein, T-cell, 12-kD; FKBP12-Exip3; calstabin-1; immunophilin FKBP12; protein kinase C inhibitor 2; rotamase; FK506 binding protein 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcaggcaacgcgctgagggactaggcagagccgtggaaccgccgccaggtcgctgttggtccacgccgcccgtcgcgccgcccgcccgctcagcgtccgccgccgccatgggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgcttgaagatggaaagaaatttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat containing 3 - deiodinase, iodothyronine, type I - hypothetical protein FLJ11235 - hypothetical protein FLJ20184 |