PTXBC106725
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC106725 |
Product type: | DNA & cDNA |
Ncbi symbol: | PLA2G1B |
Origin species: | Human |
Product name: | PLA2G1B-phospholipase A2, group IB (pancreas) Gene |
Size: | 2ug |
Accessions: | BC106725 |
Gene id: | 5319 |
Gene description: | phospholipase A2, group IB (pancreas) |
Synonyms: | PLA2; PLA2A; PPLA2; phospholipase A2; phosphatidylcholine 2-acylhydrolase 1B; phospholipase A2, group IB (pancreas); phospholipase A2 group IB |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaaactccttgtgctagctgtgctgctcacagtggccgccgccgacagcggcatcagccctcgggccgtgtggcagttccgcaaaatgatcaagtgcgtgatcccggggagtgaccccttcttggaatacaacaactacggctgctactgtggcttggggggctcaggcacccccgtggatgaactggacaagtgctgccagacacatgacaactgctatgaccaggccaagaagctggacagctgtaaatttctgctggacaacccgtacacccacacctattcatactcgtgctctggctcggcaatcacctgtagcagcaaaaacaaagagtgtgaggccttcatttgcaactgcgaccgcaacgctgccatctgcttttcaaaagctccatataacaaggcacacaagaacctggacaccaagaagtattgtcagagttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - D4, zinc and double PHD fingers family 1 - heparan sulfate 6-O-sulfotransferase 1 - regulator of G-protein signaling like 1 - cyclic nucleotide gated channel alpha 3 |