Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CSF2-colony stimulating factor 2 (granulocyte-macrophage) Gene
PTXBC113999
New product
Data sheet of CSF2-colony stimulating factor 2 (granulocyte-macrophage) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CSF2-colony stimulating factor 2 (granulocyte-macrophage) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113999 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CSF2 |
| Origin species: | Human |
| Product name: | CSF2-colony stimulating factor 2 (granulocyte-macrophage) Gene |
| Size: | 2ug |
| Accessions: | BC113999 |
| Gene id: | 1437 |
| Gene description: | colony stimulating factor 2 (granulocyte-macrophage) |
| Synonyms: | GMCSF; granulocyte-macrophage colony-stimulating factor; CSF; colony stimulating factor 2 (granulocyte-macrophage); granulocyte macrophage-colony stimulating factor; molgramostin; sargramostim; colony stimulating factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggctgcagagcctgctgctcttgggcactgtggcctgcagcatctctgcacccgcccgctcgcccagccccagcacgcagccctgggagcatgtgaatgccatccaggaggcccggcgtctcctgaacctgagtagagacactgctgctgagatgaatgaaacagtagaagtcatctcagaaatgtttgacctccaggagccgacctgcctacagacccgcctggagctgtacaagcagggcctgcggggcagcctcaccaagctcaagggccccttgaccatgatggccagccactacaagcagcactgccctccaaccccggaaacttcctgtgcaacccagattatcacctttgaaagtttcaaagagaacctgaaggactttctgcttgtcatcccctttgactgctgggagccagtccaggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 2, subfamily A, member 4 - olfactory receptor, family 5, subfamily L, member 1 - olfactory receptor, family 1, subfamily E, member 2 - olfactory receptor, family 1, subfamily D, member 2 |