Cart 3 Product Products 340,20 € (empty)
-
1 x HIST1H4A-h...113,40 € -
1 x C5orf23-ch...113,40 € -
1 x CSDC2-cold...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
Data sheet of FLJ31222-hypothetical LOC388387 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ31222-hypothetical LOC388387 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC122868 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ31222 |
| Origin species: | Human |
| Product name: | FLJ31222-hypothetical LOC388387 Gene |
| Size: | 2ug |
| Accessions: | BC122868 |
| Gene id: | 388387 |
| Gene description: | hypothetical LOC388387 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaactggccagatcaactgctgtcaccttctaaagagagggttttgccatgttgccaggctggtctcgaactcctggactcaagtgatctgcctgcctcagcctcccaaagtgctggaattataggacccagacggggaggaggaatgccagagaagctgcagactctccggccacggagcctgagtggagcagaggtggcccactgtcagccacaggtcaagtgtcagggtggggacggggcaggctccaccagaaggcgggggcaggctccaccagaaggcggggccagaccacagggcaaggtggagatgagtctgtggcacccccaggaagtttaccagatttgccccagagcttctgaccctttggatctctctgggctgcattcttcagggtcccattgcttctttcttgaaggtggaaggaaatgttcccatcagagccttccaacaggccaccttgggggcttctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 1, H3f - histone cluster 1, H3b - fibroblast growth factor 6 - spindlin family, member 4 |