Cart 1 Product Products 121,50 € (empty)
-
1 x TECTB-tect...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of KRTAP9-4-keratin associated protein 9-4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP9-4-keratin associated protein 9-4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121094 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP9-4 |
| Origin species: | Human |
| Product name: | KRTAP9-4-keratin associated protein 9-4 Gene |
| Size: | 2ug |
| Accessions: | BC121094 |
| Gene id: | 85280 |
| Gene description: | keratin associated protein 9-4 |
| Synonyms: | KAP9.4; KRTAP9.4; keratin-associated protein 9-4; keratin-associated protein 9.4; ultrahigh sulfur keratin-associated protein 9.4; keratin associated protein 9-4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacccactgttgctccccttgctgtcagcctacatgctgcaggaccacctgctgcaggaccacctgctggaagcccaccactgtgaccacctgcagcagcacaccctgctgccagccctcctgctgtgtgtccagctgctgccagccttgctgccgcccaacttgctgtcaaaacacctgctgccagcccacctgtgtgaccagctgctgccagccttcctgctgcagcacaccctgctgccagcccacctgctgtgggtccagctgtgaccagagcagctcctgtgcacctgtgtactgcagaagaacctgctactaccccacaactgtctgcctgcctggttgcctaaaccagagctgtggctccaactgctgccagccctgctgccgcccagcctgctgtgagaccacttgcttccagcccacctgtgtgtacagctgctgtcagcctttttgctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor pseudogene - ribosomal protein S4, Y-linked 1 - RAB5C, member RAS oncogene family - RAB6C, member RAS oncogene family |