Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CLC-Charcot-Leyden crystal protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLC-Charcot-Leyden crystal protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119711 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLC |
| Origin species: | Human |
| Product name: | CLC-Charcot-Leyden crystal protein Gene |
| Size: | 2ug |
| Accessions: | BC119711 |
| Gene id: | 1178 |
| Gene description: | Charcot-Leyden crystal protein |
| Synonyms: | GAL10; Gal-10; LGALS10; LGALS10A; LPPL_HUMAN; galectin-10; Charcot-Leyden crystal protein; eosinophil lysophospholipase; lectin, galactoside-binding, soluble, 10; lysolecithin acylhydrolase; Charcot-Leyden crystal galectin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccctgctacccgtgccatacacagaggctgcctctttgtctactggttctactgtgacaatcaaagggcgaccacttgtctgtttcttgaatgaaccatatctgcaggtggatttccacactgagatgaaggaggaatcagacattgtcttccatttccaagtgtgctttggtcgtcgtgtggtcatgaacagccgtgagtatggggcctggaagcagcaggtggaatccaagaacatgccctttcaggatggccaagaatttgaactgagcatctcagtgctgccagataagtaccaggtaatggtcaatggccaatcctcttacacctttgaccatagaatcaagcctgaggctgtgaagatggtgcaagtgtggagagatatctccctgaccaaatttaatgtcagctatttaaagagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polycomb group ring finger 3 - lin-7 homolog A (C. elegans) - MAGI family member, X-linked - deltex 3 homolog (Drosophila) |