FAM12A-family with sequence similarity 12, member A Gene View larger

FAM12A-family with sequence similarity 12, member A Gene

PTXBC106711

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM12A-family with sequence similarity 12, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM12A-family with sequence similarity 12, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC106711
Product type: DNA & cDNA
Ncbi symbol: FAM12A
Origin species: Human
Product name: FAM12A-family with sequence similarity 12, member A Gene
Size: 2ug
Accessions: BC106711
Gene id: 10876
Gene description: family with sequence similarity 12, member A
Synonyms: FAM12A; EP3A; HE3-ALPHA; HE3A; HE3ALPHA; RAM1; epididymal secretory protein E3-alpha; epididymis-specific 3 alpha; family with sequence similarity 12, member A; human epididymis-specific 3 alpha; human epididymis-specific protein 3-alpha; ribonuclease A M1; epididymal protein 3A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacatcctctctaaagatttggggcatactcttggccctgctttgcatcctttgcaggctgtgtgtatacagtaacaacatttactggagagaattcataaaacttcattacttaagtccaagtcgagaattcaaagagtacaaatgtgatgtcctcatgagagaaaaagaggctctgaaaggcaagagctttcatatgttcatctatagcttatggttcaaaattcagcgtgcatgcatcaatgagaaggggagcgaccgatatagaaatgcatatgtatgggccccaggtgccctcaaagtactcgagtgtcactgggagaagtacaacaataggtacacagagagcagaagcttcagctacattgaattccattgtggcgtagatggatatgttgataacatagaagacctgaggattatagaacctatcagcaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - purinergic receptor P2Y, G-protein coupled, 5
- leucine rich repeat transmembrane neuronal 4
- CWF19-like 2, cell cycle control (S. pombe)
- family with sequence similarity 40, member A

Reviews

Buy FAM12A-family with sequence similarity 12, member A Gene now

Add to cart