CGB5-chorionic gonadotropin, beta polypeptide 5 Gene View larger

CGB5-chorionic gonadotropin, beta polypeptide 5 Gene

PTXBC106724

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CGB5-chorionic gonadotropin, beta polypeptide 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CGB5-chorionic gonadotropin, beta polypeptide 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC106724
Product type: DNA & cDNA
Ncbi symbol: CGB5
Origin species: Human
Product name: CGB5-chorionic gonadotropin, beta polypeptide 5 Gene
Size: 2ug
Accessions: BC106724
Gene id: 93659
Gene description: chorionic gonadotropin, beta polypeptide 5
Synonyms: CGB; HCG; hCGB; chorionic gonadotropin, beta polypeptide 5; chorionic gonadotropin beta 5 subunit; chorionic gonadotropin beta subunit; chorionic gonadotropin beta subunit 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagatgctccaggggctgctgctgttgctgctgctgagcatgggcgggacatgggcatccaaggagccgcttcggccacggtgccgccccatcaatgccaccctggctgtggagaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcagggggtcctgccggccctgcctcaggtggtgtgcaactaccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgtggtctcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgtgatgacccccgcttccaggactcctcttcctcaaaggcccctccccccagccttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and SOCS box-containing 14
- phosphoribosyl pyrophosphate synthetase 2
- alpha-1,4-N-acetylglucosaminyltransferase
- ankyrin repeat and SOCS box-containing 11

Reviews

Buy CGB5-chorionic gonadotropin, beta polypeptide 5 Gene now

Add to cart