PTXBC106724
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC106724 |
Product type: | DNA & cDNA |
Ncbi symbol: | CGB5 |
Origin species: | Human |
Product name: | CGB5-chorionic gonadotropin, beta polypeptide 5 Gene |
Size: | 2ug |
Accessions: | BC106724 |
Gene id: | 93659 |
Gene description: | chorionic gonadotropin, beta polypeptide 5 |
Synonyms: | CGB; HCG; hCGB; chorionic gonadotropin, beta polypeptide 5; chorionic gonadotropin beta 5 subunit; chorionic gonadotropin beta subunit; chorionic gonadotropin beta subunit 5 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggagatgctccaggggctgctgctgttgctgctgctgagcatgggcgggacatgggcatccaaggagccgcttcggccacggtgccgccccatcaatgccaccctggctgtggagaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcagggggtcctgccggccctgcctcaggtggtgtgcaactaccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgtggtctcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgtgatgacccccgcttccaggactcctcttcctcaaaggcccctccccccagccttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - ankyrin repeat and SOCS box-containing 14 - phosphoribosyl pyrophosphate synthetase 2 - alpha-1,4-N-acetylglucosaminyltransferase - ankyrin repeat and SOCS box-containing 11 |