Cart 6 Product Products 683,21 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 € -
1 x ARMCX3-arm...121,50 € -
1 x RRP15-ribo...113,40 €
No products
To be determined Shipping
683,21 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 683,21 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 683,21 €
View larger 
STELLAR-germ and embryonic stem cell enriched protein STELLA Gene
PTXBC125145
New product
Data sheet of STELLAR-germ and embryonic stem cell enriched protein STELLA Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STELLAR-germ and embryonic stem cell enriched protein STELLA Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125145 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STELLAR |
| Origin species: | Human |
| Product name: | STELLAR-germ and embryonic stem cell enriched protein STELLA Gene |
| Size: | 2ug |
| Accessions: | BC125145 |
| Gene id: | 400206 |
| Gene description: | germ and embryonic stem cell enriched protein STELLA |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacccatcacagtttaatccaacctacatcccagggtctccacaaatgctcaccgaagaaaattcccgggacgattcaggggcctctcaaatctcctccgagacgttgataaagaaccttagtaacttgactatcaacgctagtagcgaatctgtttcccctctattggaagctttactccgtcgagagtctgtgggggcagcagtcctcagggaaatcgaagatgagtggctttacagcaggagaggagtaagaacactgctgtctgtgcagagagaaaagatggcaagattgagatacatgttactgggcggagttcgtacgcatgaaagaagaccaacaaacaaggagcctaagggagttaagaaggaatcaagaccattcaaatgtccctgcagtttctgcgtgtctaatggatgggatccttctgagaatgctagaatagagaatcaagacaccaagccacttcagccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, alpha type, 5 - killer cell lectin-like receptor subfamily B, member 1 - triggering receptor expressed on myeloid cells-like 2 - cytochrome P450, family 2, subfamily C, polypeptide 9 |