> >>KRTAP12-2-keratin associated protein 12-2 Gene
KRTAP12-2-keratin associated protein 12-2 Gene View larger

KRTAP12-2-keratin associated protein 12-2 Gene

PTXBC120941

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of KRTAP12-2-keratin associated protein 12-2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRTAP12-2-keratin associated protein 12-2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC120941
Product type: DNA & cDNA
Ncbi symbol: KRTAP12-2
Origin species: Human
Product name: KRTAP12-2-keratin associated protein 12-2 Gene
Size: 2ug
Accessions: BC120941
Gene id: 353323
Gene description: keratin associated protein 12-2
Synonyms: KAP12.2; KRTAP12.2; keratin-associated protein 12-2; high sulfur keratin-associated protein 12.2; keratin-associated protein 12.2; keratin associated protein 12-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtcataccagctgctcctcgggctgccagccagcctgctgcgcgcccagcccctgccagccagcctgttgtgtgcccagctcctgccaggcatcctgctgtgtgcctgtgggctgccagtcctccgtgtgtgtgcccgtgagcttcaagccagccgtgtgcctgcccgtgagctgccagtcttctgtgtgtgtgcccatgagcttcaagtcagctgtgtgcgtgcccgtgagctgccagtcttctgtgtgtgtgcctgtgagctgcaggcccattgtgtgtgcagccccctcctgccagtcctccctgtgcgtgcctgtgagctgcaggcctgtcgtgtatgcggctccgtcctgccagtcctctgggtgctgccagccctcctgcaccagcgtcctctgcagacccatctcctacagtatctcttcctgctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - taste receptor, type 2, member 46
- keratin associated protein 10-1
- keratin associated protein 10-5
- abhydrolase domain containing 12B

Reviews

Buy KRTAP12-2-keratin associated protein 12-2 Gene now

Add to cart