> >>TBRG1-transforming growth factor beta regulator 1 Gene
TBRG1-transforming growth factor beta regulator 1 Gene View larger

TBRG1-transforming growth factor beta regulator 1 Gene

PTXBC109269

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of TBRG1-transforming growth factor beta regulator 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TBRG1-transforming growth factor beta regulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC109269
Product type: DNA & cDNA
Ncbi symbol: TBRG1
Origin species: Human
Product name: TBRG1-transforming growth factor beta regulator 1 Gene
Size: 2ug
Accessions: BC109269
Gene id: 84897
Gene description: transforming growth factor beta regulator 1
Synonyms: NIAM; TB-5; transforming growth factor beta regulator 1; nuclear interactor of ARF and MDM2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtgcccagaccagaagtgtctatatacctgtcagatcaaggatggtggtgtgcagcctcagtttgaaattgttcctgaagatgacccccagaatgccattgtcagctcttctgcagatgcttgtcatgcagaactgctcaggactataagcactactatggggaaactaatgcctaacctgcttccagctggagctgacttttttggattttctcatccagccatccacaacctgatccagagctgtccaggagctcgaaaatgcatcaattaccagtgggtgaaatttgatgtgtgcaaacctggagatgggcagctacctgaggggctgccggagaatgatgcagctatgagctttgaagcctttcagagacagatctttgatgaagatcagaatgatccccttctgccaggatccttggacctcccagagcttcagcctgcagcctttgtgtcttcttaccagcccatgtacctgacacatgaacccttggtagatactcacctgcagcacttgaagtctccatcacagggtagcccaattcagtcttcagattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 9, member B
- chloride channel, nucleotide-sensitive, 1A
- hypothetical gene supported by BC067869
- lysosomal multispanning membrane protein 5

Reviews

Buy TBRG1-transforming growth factor beta regulator 1 Gene now

Add to cart