PTXBC109269
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC109269 |
Product type: | DNA & cDNA |
Ncbi symbol: | TBRG1 |
Origin species: | Human |
Product name: | TBRG1-transforming growth factor beta regulator 1 Gene |
Size: | 2ug |
Accessions: | BC109269 |
Gene id: | 84897 |
Gene description: | transforming growth factor beta regulator 1 |
Synonyms: | NIAM; TB-5; transforming growth factor beta regulator 1; nuclear interactor of ARF and MDM2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaagtgcccagaccagaagtgtctatatacctgtcagatcaaggatggtggtgtgcagcctcagtttgaaattgttcctgaagatgacccccagaatgccattgtcagctcttctgcagatgcttgtcatgcagaactgctcaggactataagcactactatggggaaactaatgcctaacctgcttccagctggagctgacttttttggattttctcatccagccatccacaacctgatccagagctgtccaggagctcgaaaatgcatcaattaccagtgggtgaaatttgatgtgtgcaaacctggagatgggcagctacctgaggggctgccggagaatgatgcagctatgagctttgaagcctttcagagacagatctttgatgaagatcagaatgatccccttctgccaggatccttggacctcccagagcttcagcctgcagcctttgtgtcttcttaccagcccatgtacctgacacatgaacccttggtagatactcacctgcagcacttgaagtctccatcacagggtagcccaattcagtcttcagattga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 9, member B - chloride channel, nucleotide-sensitive, 1A - hypothetical gene supported by BC067869 - lysosomal multispanning membrane protein 5 |