> >>SFRS12IP1-SFRS12-interacting protein 1 Gene
SFRS12IP1-SFRS12-interacting protein 1 Gene View larger

SFRS12IP1-SFRS12-interacting protein 1 Gene

PTXBC127085

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SFRS12IP1-SFRS12-interacting protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SFRS12IP1-SFRS12-interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC127085
Product type: DNA & cDNA
Ncbi symbol: SFRS12IP1
Origin species: Human
Product name: SFRS12IP1-SFRS12-interacting protein 1 Gene
Size: 2ug
Accessions: BC127085
Gene id: 285672
Gene description: SFRS12-interacting protein 1
Synonyms: protein SFRS12IP1; SFRS12IP1; P18SRP; protein SREK1IP1; SFRS12-interacting protein 1; p18 splicing regulatory protein; splicing regulatory protein of 18 kDa; SREK1 interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtcccaggttgcaacaaggacagtgtcagagcaggctgtaaaaaatgtggctaccctggtcacctgacttttgaatgccgcaattttctccgagtagaccctaaaagggacatagttttggatgtcagcagtacaagtagtgaagatagcgatgaagagaatgaagaactgaataaattgcaggcattacaggaaaaaagaataaatgaagaagaggaaaagaagaaagaaaaaagcaaagaaaaaatcaaattgaaaaaaaaaaggaaaaggtcttactcatccagttccactgaagaggacacttcaaaacaaaagaaacaaaaatatcagaagaaagaaaagaaaaaagaaaaaaagagtaaatcaaaaaaagggaaacatcacaaaaaggaaaaaaagaagagaaaaaaggaaaagcattcttctacacctaatagttctgaattctccagaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein FLJ13224
- hypothetical protein FLJ37201
- FK506 binding protein 1A, 12kDa
- leucine rich repeat containing 3

Reviews

Buy SFRS12IP1-SFRS12-interacting protein 1 Gene now

Add to cart