Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RIPPLY1-ripply1 homolog (zebrafish) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RIPPLY1-ripply1 homolog (zebrafish) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC105692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIPPLY1 |
| Origin species: | Human |
| Product name: | RIPPLY1-ripply1 homolog (zebrafish) Gene |
| Size: | 2ug |
| Accessions: | BC105692 |
| Gene id: | 92129 |
| Gene description: | ripply1 homolog (zebrafish) |
| Synonyms: | ripply1 homolog; protein ripply1; ripply transcriptional repressor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactctgctgcctgtgctgctgctgccacccctgttccagccctggctttggccctagctccagacctagcacaagccccactggcactccctggcctgttaagcccatcttgccttctctcctctggacaagaagtaaatgggagtgaaagaggaacttgtctctggaggccctggctgtcttccacaaatgactccccaaggcagatgaggaagctggtggatttggctgctggtggggcaacggctgctgaggtcaccaaggctgaatccaagttccatcaccctgtcaggctcttctggcctaaatcccgctccttcgactatctgtacagtgctggggagattttactgcagaactttcctgtccaggcaaccatcaacctatacgaggactcagacagcgaagaagaagaggaagatgaagagcaggaggatgaagaagagaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - D-amino acid oxidase activator - slowmo homolog 1 (Drosophila) - neuropeptides B/W receptor 1 - G protein-coupled receptor 68 |