HIST3H2BB-histone cluster 3, H2bb Gene View larger

HIST3H2BB-histone cluster 3, H2bb Gene

PTXBC100855

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST3H2BB-histone cluster 3, H2bb Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST3H2BB-histone cluster 3, H2bb Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC100855
Product type: DNA & cDNA
Ncbi symbol: HIST3H2BB
Origin species: Human
Product name: HIST3H2BB-histone cluster 3, H2bb Gene
Size: 2ug
Accessions: BC100855
Gene id: 128312
Gene description: histone cluster 3, H2bb
Synonyms: H2Bb; histone H2B type 3-B; H2B type 12; histone 3, H2bb; histone cluster 3, H2bb; histone cluster 3 H2B family member b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagacccgtccaaatcggctcctgcgcccaagaagggttctaaaaaggctgtcaccaaggcacagaagaaggacggcaagaagcgcaagcgcggccgcaaggagagctattctatctacgtgtacaaggtgctgaagcaggtgcaccccgacaccggcatctcgtccaaggccatgggcatcatgaactccttcgtcaatgacatcttcgagcgcatcgccagcgaggcctcccgcctggcacactacaacaagcgctccaccatcacgtcccgcgaagtgcagacggccgttcgcctgctgctgcccggcgagctggccaagcacgccgtgtccgagggcaccaaggctgtcaccaagtacaccagctccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 134
- troponin I type 3 (cardiac)
- mortality factor 4 like 1
- BCL2-associated athanogene 2

Reviews

Buy HIST3H2BB-histone cluster 3, H2bb Gene now

Add to cart