SYNC-syncoilin, intermediate filament protein Gene View larger

SYNC-syncoilin, intermediate filament protein Gene

PTXBC119700

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SYNC-syncoilin, intermediate filament protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SYNC-syncoilin, intermediate filament protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC119700
Product type: DNA & cDNA
Ncbi symbol: SYNC
Origin species: Human
Product name: SYNC-syncoilin, intermediate filament protein Gene
Size: 2ug
Accessions: BC119700
Gene id: 81493
Gene description: syncoilin, intermediate filament protein
Synonyms: SYNC1; SYNCOILIN; intermediate filament protein syncoilin; syncoilin intermediate filament 1; syncoilin-1; syncoilin, intermediate filament protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagagagccgccaggacctggaggaggagtatgagcctcagttcctgcggctcctagagaggaaagaagctgggaccaaagctctgcagagaacccaggctgagatccaggaaatgaaggaggctctgagacccctgcaagcagaggcccggcagctccgcctgcaaaacaggaacctggaggaccagatcgcacttgtgaggcaaaaacgagatgaagaggtgcagcagtacagggaacagctggaggaaatggaagaacgccagaggcagttaagaaatggggtgcaactccagcaacagaagaacaaagagatggaacagctaaggctcagtcttgctgaagagctctctacttataaggctatgctactacccaagagcctggaacaggctgatgctcccacttctcaggcaggtggaatggagacacagtctcaaggggctgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NOL1/NOP2/Sun domain family, member 5B
- peroxisomal biogenesis factor 11 alpha
- phospholipase A2, group IB (pancreas)
- D4, zinc and double PHD fingers family 1

Reviews

Buy SYNC-syncoilin, intermediate filament protein Gene now

Add to cart