Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1G2-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 Gene
PTXBC119726
New product
Data sheet of ATP6V1G2-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1G2-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119726 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1G2 |
| Origin species: | Human |
| Product name: | ATP6V1G2-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 Gene |
| Size: | 2ug |
| Accessions: | BC119726 |
| Gene id: | 534 |
| Gene description: | ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 |
| Synonyms: | ATP6G; ATP6G2; NG38; VMA10; V-type proton ATPase subunit G 2; ATPase, H+ transporting, lysosomal (vacuolar proton pump); ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2; H(+)-transporting two-sector ATPase, subunit G2; V-ATPase 13 kDa subunit 2; vacuolar ATP synthase subunit G 2; vacuolar proton pump G subunit 2; ATPase H+ transporting V1 subunit G2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagtcagtcccaaggtatccagcagcttctgcaagctgagaagcgggcagctgagaaggtggcagatgccagaaagaggaaggcccggcgactgaagcaggcaaaggaggaggcacagatggaggtggagcaataccgcagagagcgagagcacgaattccagagcaagcagcaggcggccatgggctcccaggggaacctgtctgctgaggtggagcaggctacaaggcgccaggtgcagggcatgcagagctcccagcagagaaaccgagagcgtgtcctggcccagcttcttggcatggtctgcgacgtcaggccccaggtccaccccaactaccggatttctgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine-rich repeat-containing G protein-coupled receptor 5 - roundabout, axon guidance receptor, homolog 1 (Drosophila) - nuclear factor of activated T-cells 5, tonicity-responsive - pleckstrin homology domain containing, family A member 5 |