PTXBC125183
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC125183 |
Product type: | DNA & cDNA |
Ncbi symbol: | C13orf37 |
Origin species: | Human |
Product name: | C13orf37-chromosome 13 open reading frame 37 Gene |
Size: | 2ug |
Accessions: | BC125183 |
Gene id: | 440145 |
Gene description: | chromosome 13 open reading frame 37 |
Synonyms: | C13orf37; MOZART1; mitotic-spindle organizing protein 1; mitotic-spindle organizing protein associated with a ring of gamma-tubulin 1; mitotic spindle organizing protein 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcgagtagcggcggtgctggggcggcggcggcggccgcggcggcgaatctgaatgcggtgcgggagaccatggacgttctgcttgagatttcaagaattttgaatactggcttagatatggaaactctgtctatttgtgtacggctttgtgaacaaggaattaacccagaagctttatcatcggttattaaggagcttcgcaaggctactgaagcactgaaggctgctgaaaatatgacaagctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 21 open reading frame 88 - chromosome 15 open reading frame 53 - chromosome 6 open reading frame 122 - chromosome 6 open reading frame 184 |