Cart 17 Product Products 2 380,54 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 € -
1 x UBL5-ubiqu...113,40 € -
1 x RPL23A-rib...113,40 € -
1 x ZNF266-zin...113,40 € -
1 x PGDS-prost...113,40 € -
1 x DLX6-dista...113,40 € -
-
1 x SMAP2-smal...121,50 €
No products
To be determined Shipping
2 380,54 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 380,54 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 380,54 €
Data sheet of CRYGA-crystallin, gamma A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRYGA-crystallin, gamma A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC114456 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRYGA |
| Origin species: | Human |
| Product name: | CRYGA-crystallin, gamma A Gene |
| Size: | 2ug |
| Accessions: | BC114456 |
| Gene id: | 1418 |
| Gene description: | crystallin, gamma A |
| Synonyms: | CRY-g-A; CRYG1; CRYG5; gamma-crystallin A; crystallin, gamma 1; gamma-crystallin 5; crystallin gamma A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcgtcccaattaccagggccaccagtacttcctgcgccgagaccagctcgcacaagttaaggctgtacgagagagatgactaccgaggccttatgtctgagctcactgatgactgcgcctgtgttccagaactgttccgtctccctgagatctattccctccacgtactggagggctgctgggtcctctatgaaatgcccaactaccgggggcggcagtatctgctgaggcctggggactacagaaggtaccacgactgggggggtgcagatgccaaagtcggctctttgagacgggtcaccgatttgtactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interferon, alpha 6 - chymase 1, mast cell - butyrophilin-like 8 - toll-like receptor 6 |