> >>CCL4-chemokine (C-C motif) ligand 4 Gene
CCL4-chemokine (C-C motif) ligand 4 Gene View larger

CCL4-chemokine (C-C motif) ligand 4 Gene

PTXBC104226

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of CCL4-chemokine (C-C motif) ligand 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCL4-chemokine (C-C motif) ligand 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC104226
Product type: DNA & cDNA
Ncbi symbol: CCL4
Origin species: Human
Product name: CCL4-chemokine (C-C motif) ligand 4 Gene
Size: 2ug
Accessions: BC104226
Gene id: 6351
Gene description: chemokine (C-C motif) ligand 4
Synonyms: ACT2; AT744.1; G-26; HC21; LAG-1; LAG1; MIP-1-beta; MIP1B; MIP1B1; SCYA2; SCYA4; C-C motif chemokine 4; G-26 T-lymphocyte-secreted protein; MIP-1-beta(1-69); PAT 744; SIS-gamma; T-cell activation protein 2; chemokine (C-C motif) ligand 4; lymphocyte activation gene 1 protein; macrophage inflammatory protein 1-beta; secreted protein G-26; small inducible cytokine A4 (homologous to mouse Mip-1b); C-C motif chemokine ligand 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctctgcgtgactgtcctgtctctcctcatgctagtagctgccttctgctctccagcgctctcagcaccaatgggctcagaccctcccaccgcctgctgcttttcttacaccgcgaggaagcttcctcgcaactttgtggtagattactatgagaccagcagcctctgctcccagccagctgtggtattccaaaccaaaagaagcaagcaagtctgtgctgatcccagtgagacctgggtccaggagtacgtgtatgacctggaactgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LY6/PLAUR domain containing 2
- ripply1 homolog (zebrafish)
- D-amino acid oxidase activator
- slowmo homolog 1 (Drosophila)

Reviews

Buy CCL4-chemokine (C-C motif) ligand 4 Gene now

Add to cart