Cart 30 Product Products 5 726,45 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
-
1 x UGCG-UDP-g...121,50 € -
1 x GEMIN7-gem...113,40 € -
1 x TMEM53-tra...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
1 x C14orf100-...121,50 € -
1 x CCDC115-co...113,40 € -
1 x IL17F-inte...113,40 € -
-
-
1 x SERINC1-se...121,50 € -
1 x LDHA-lacta...121,50 € -
1 x ZNF69-zinc...113,40 € -
1 x ROPN1B-rop...113,40 € -
1 x GHRL-ghrel...113,40 € -
1 x SERPINA3-s...121,50 € -
1 x IFT81-intr...121,50 € -
-
-
1 x SERPINB8-s...113,40 €
No products
To be determined Shipping
5 726,45 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 30 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 726,45 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 726,45 €
Data sheet of DKFZp566H0824-hypothetical LOC54744 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DKFZp566H0824-hypothetical LOC54744 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104430 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DKFZp566H0824 |
| Origin species: | Human |
| Product name: | DKFZp566H0824-hypothetical LOC54744 Gene |
| Size: | 2ug |
| Accessions: | BC104430 |
| Gene id: | 54744 |
| Gene description: | hypothetical LOC54744 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacagcacatagagctggaggggtgggccagcagcaaccaggagaaggcgttccaggtgtctgcacccaaggagatcctggggtcagaggcaggacatgtgggaaaaaccattggtcccttttacccagggaaggactcaagaagccgaacgtggtaggagatggaggctcccaagccctggcagacgttacagcagcgctgagcactttcaggaccaggactccaaggtccagctctggaacgcccctctctgccctgactttggttccttcatcagcagaggggctcctgggctatgggctcaagtctgaagtcaccttaaagagaaatctctacctttctgttctccttcattgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) ligand 4 - LY6/PLAUR domain containing 2 - ripply1 homolog (zebrafish) - D-amino acid oxidase activator |