PTXBC119686
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC119686 |
Product type: | DNA & cDNA |
Ncbi symbol: | BPESC1 |
Origin species: | Human |
Product name: | BPESC1-blepharophimosis, epicanthus inversus and ptosis, candidate 1 Gene |
Size: | 2ug |
Accessions: | BC119686 |
Gene id: | 60467 |
Gene description: | blepharophimosis, epicanthus inversus and ptosis, candidate 1 |
Synonyms: | NCRNA00187; blepharophimosis, epicanthus inversus and ptosis, candidate 1 (non-protein coding) |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggaggaagagatcaaatcacaaatcttgggagtgagggagagacacatccttggggctactcaagtcccccatatcctttgcataccttctttatcccttttctacccagtggatttggagggagtgggcttgggataccatcagacaacgagaaacacgatttgcaggactgtgtggaggtatccaggcctgagggccctgctccagagctcccctcctcactctgtggctggaacaaaatctcttccttgtgtggccttggcttccctagcagggatcccaaaacatgggatctggccatgctgctcagtccttgggttgatttctttgagctccagcttctctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 - potassium inwardly-rectifying channel, subfamily J, member 11 - solute carrier family 29 (nucleoside transporters), member 3 |