Cart 13 Product Products 1 450,14 € (empty)
-
-
1 x PTGR2-pros...121,50 € -
-
1 x PDCL3-phos...113,40 € -
1 x OR10H1-olf...121,50 € -
1 x YIPF2-Yip1...121,50 € -
-
1 x MAPKSP1-MA...113,40 € -
1 x BID-BH3...113,40 € -
1 x CD244-CD24...121,50 € -
1 x PAPLN-papi...113,40 € -
-
1 x ARL17-ADP-...113,40 €
No products
To be determined Shipping
1 450,14 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 450,14 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 450,14 €
Data sheet of LOC203547-hypothetical protein LOC203547 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC203547-hypothetical protein LOC203547 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC105694 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC203547 |
| Origin species: | Human |
| Product name: | LOC203547-hypothetical protein LOC203547 Gene |
| Size: | 2ug |
| Accessions: | BC105694 |
| Gene id: | 203547 |
| Gene description: | hypothetical protein LOC203547 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcgcccggataaggcggcgctgaacgcactgcagcctcctgagttcagaaatgaaagctcattagcatctacactgaagacgctcctgttcttcacagctttaatgatcactgttcctattgggttatatttcacaactaaatcttacatatttgaaggcgcccttgggatgtccaatagggacagctatttttacgctgctattgttgcagtggtcgccgtccatgtggtgctggccctctttgtgtatgtggcctggaatgaaggctcacgacagtggcgtgaaggcaaacaggattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein LOC283332 - chromosome X open reading frame 1 - retinol binding protein 1, cellular - hypothetical protein LOC284749 |