Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LOC57228-small trans-membrane and glycosylated protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC57228-small trans-membrane and glycosylated protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC120965 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC57228 |
| Origin species: | Human |
| Product name: | LOC57228-small trans-membrane and glycosylated protein Gene |
| Size: | 2ug |
| Accessions: | BC120965 |
| Gene id: | 57228 |
| Gene description: | small trans-membrane and glycosylated protein |
| Synonyms: | hSMAGP; small cell adhesion glycoprotein; small cell transmembrane and glycosylated protein; small trans-membrane and glycosylated protein; small transmembrane and glycosylated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccagcctcctgactactccttctccaagagaagaactgatgaccaccccaattttacagcccactgaggccctgtccccagaagatggagccagcacagcactcattgcagttgttatcaccgttgtcttcctcaccctgctctcggtcgtgatcttgatcttcttttacctgtacaagaacaaaggcagctacgtcacctatgaacctacagaaggtgagcccagtgccatcgtccagatggagagtgacttggccaagggcagcgagaaagaggaatatttcatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - adiponectin, C1Q and collagen domain containing - PTC7 protein phosphatase homolog (S. cerevisiae) - acyl-CoA synthetase medium-chain family member 1 - N-acetylated alpha-linked acidic dipeptidase 2 |