SPRR2A-small proline-rich protein 2A Gene

View larger

SPRR2A-small proline-rich protein 2A Gene

Reference: PTXBC096108

Condition: New product

Print

Data sheet of SPRR2A-small proline-rich protein 2A Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SPRR2A-small proline-rich protein 2A Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC096108
Product type:	DNA & cDNA
Ncbi symbol:	SPRR2A
Origin species:	Human
Product name:	SPRR2A-small proline-rich protein 2A Gene
Size:	2ug
Accessions:	BC096108
Gene id:	6700
Gene description:	small proline-rich protein 2A
Synonyms:	small proline-rich protein 2A; SPR-2A; small proline rich protein 2A
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtcttatcaacagcagcagtgcaagcagccctgccagccacctcctgtgtgccccacgccaaagtgcccagaaccatgtccacccccgaagtgccctgagccctgcccaccaccaaagtgtccacagccctgcccacctcagcagtgccagcagaaatatcctcctgtgacaccttccccaccctgccagtcaaagtatccaccgaagagcaagtaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- glycophorin B (MNS blood group) - disrupted in renal carcinoma 1 - interferon, beta 1, fibroblast - SH3 and cysteine rich domain 2

Reviews

Be the first to write your review !

Buy SPRR2A-small proline-rich protein 2A Gene now