H2BFS-H2B histone family, member S Gene View larger

H2BFS-H2B histone family, member S Gene

PTXBC126369

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of H2BFS-H2B histone family, member S Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about H2BFS-H2B histone family, member S Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC126369
Product type: DNA & cDNA
Ncbi symbol: H2BFS
Origin species: Human
Product name: H2BFS-H2B histone family, member S Gene
Size: 2ug
Accessions: BC126369
Gene id: 54145
Gene description: H2B histone family, member S
Synonyms: H2bfs; 2610022J01Rik; R74621; histone H2B type 1-C/E/G; H2B histone family, member S; histone 1, H2bc; histone cluster 1, H2bc
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggagccagcgaagtccgctcccgcgcccaagaagggctcgaagaaagccgtgactaaggcgcagaagaaggacggcaagaagcgcaagcgcagccgcaaggagagctactccgtatacgtgtacaaggtgctgaagcaggtccaccctgacaccggcatctcctctaaggccatgggaatcatgaactccttcgtcaacgacatcttcgaacgcatcgcaggtgaggcttcccgcctgccgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgctgcccggggagttggccaagcacgccgtgtccgagggcaccaaggctgtcaccaagtacaccagcgctaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thymosin-like 1 (pseudogene)
- gastric inhibitory polypeptide
- Charcot-Leyden crystal protein
- polycomb group ring finger 3

Reviews

Buy H2BFS-H2B histone family, member S Gene now

Add to cart