KRTAP19-5-keratin associated protein 19-5 Gene View larger

KRTAP19-5-keratin associated protein 19-5 Gene

PTXBC100836

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRTAP19-5-keratin associated protein 19-5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRTAP19-5-keratin associated protein 19-5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC100836
Product type: DNA & cDNA
Ncbi symbol: KRTAP19-5
Origin species: Human
Product name: KRTAP19-5-keratin associated protein 19-5 Gene
Size: 2ug
Accessions: BC100836
Gene id: 337972
Gene description: keratin associated protein 19-5
Synonyms: KAP19.5; keratin-associated protein 19-5; keratin associated protein 19-5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactactacggcaactactatggaggcctgggctacggctacggaggcttcgatgacctgggctatggctatggctgtggatgtggcagcttccgcagactgggctatggcggtggctacggaggctacggatacggctctggcttcggaggctatggataccgcagctgccgtccatcatgctatggaggatatggattctctggattttattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - B melanoma antigen family, member 3
- keratin associated protein 12-2
- taste receptor, type 2, member 46
- keratin associated protein 10-1

Reviews

Buy KRTAP19-5-keratin associated protein 19-5 Gene now

Add to cart